Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26228
Trapped Gene
Mthfsd (ENSMUSG00000031816)
Vector Insertion
Chr 8: 123630769 - 123630874
Public Clones not available
Private Clones OST129580 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706244 (Chr8:123630770..123630873 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGGATTTGGGACTACATGG Chr8:123630829..123630848 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706244 (Chr8:123630770..123630873 -)
Downstram Exon
ENSMUSE00000349260 (Chr8:123630770..123630873 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGGATTTGGGACTACATGG Chr8:123630829..123630848 59.67 50 GGTCGGGGAAAGTCAGCTAT Chr8:123630776..123630795 60.46 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710624 Chr8:123632188..123632207 No primer for this exon
upstream ENSMUSE00000721220 Chr8:123632188..123632207 No primer for this exon
upstream ENSMUSE00000678511 Chr8:123632094..123632218 GTGACGTGTTAGCCATGGAG Chr8:123632198..123632217 59.17 55
upstream ENSMUSE00000349260 Chr8:123630770..123630873 ACGGATTTGGGACTACATGG Chr8:123630829..123630848 59.67 50
upstream ENSMUSE00000706244 Chr8:123630770..123630873 ACGGATTTGGGACTACATGG Chr8:123630829..123630848 59.67 50

*** Putative Vector Insertion (Chr 8: 123630769 - 123630874) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302446 Chr8:123629618..123629731 GTCCGGGTTGACTTTAATGG Chr8:123629632..123629651 59.29 50
downstream ENSMUSE00000302422 Chr8:123628292..123628405 GTTGGGACCAGCAGTGTTTT Chr8:123628358..123628377 60.01 50
downstream ENSMUSE00000302396 Chr8:123626814..123626904 ACAGCAACAGATCCCACCAC Chr8:123626803..123626822 61 55
downstream ENSMUSE00000213301 Chr8:123625324..123625436 CACCATCATGGCGTATTCAA Chr8:123625359..123625378 60.34 45
downstream ENSMUSE00000302252 Chr8:123625019..123625144 TCAACTGTGAGGTCGTGGTC Chr8:123625073..123625092 59.71 55
downstream ENSMUSE00000706243 Chr8:123622608..123623052 TGTAGAACTGCCCTGTGCTG Chr8:123622696..123622715 60.05 55
downstream ENSMUSE00000408059 Chr8:123621840..123623052 GTTCCCAGTGGTCGTAAGGA Chr8:123622171..123622190 59.97 55
downstream ENSMUSE00000706242 Chr8:123621457..123621825 GCTCCATCCTGCTAAACTGC Chr8:123621532..123621551 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAATCTAATCGCCTTGCAG Chr8:123630809..123630829 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACATGGAATCCGTGACTGG Chr8:123630814..123630834 59.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031816