Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2624
Trapped Gene
Srf (ENSMUSG00000015605)
Vector Insertion
Chr 17: 46688742 - 46690508
Public Clones XR0430 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136841 (Chr17:46690509..46690775 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136841 (Chr17:46690509..46690775 -)
Downstram Exon
ENSMUSE00000136838 (Chr17:46688480..46688741 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000327909 Chr17:46692277..46693124 No primer for this exon
upstream ENSMUSE00000136841 Chr17:46690509..46690775 No primer for this exon

*** Putative Vector Insertion (Chr 17: 46688742 - 46690508) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136838 Chr17:46688480..46688741 No primer for this exon
downstream ENSMUSE00000136837 Chr17:46687850..46687969 No primer for this exon
downstream ENSMUSE00000136836 Chr17:46686794..46686985 No primer for this exon
downstream ENSMUSE00000136839 Chr17:46686385..46686461 No primer for this exon
downstream ENSMUSE00000327751 Chr17:46685284..46686127 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATCCCTTAATCGCCTTGC Chr17:46690445..46690465 60.41 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGAAATCCCTCGTGACTG Chr17:46690449..46690469 59.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015605