Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26240
Trapped Gene
Pth (ENSMUSG00000059077)
Vector Insertion
Chr 7: 120529593 - 120529708
Public Clones not available
Private Clones OST128985 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000501392 (Chr7:120529709..120529799 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCGTGGCTAAAGTGATGA Chr7:120529761..120529780 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000501392 (Chr7:120529709..120529799 -)
Downstram Exon
ENSMUSE00000481017 (Chr7:120529092..120529592 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCGTGGCTAAAGTGATGA Chr7:120529761..120529780 59.72 50 GGATTGCCATCAACAAGGAC Chr7:120529373..120529392 60.33 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502072 Chr7:120531965..120532086 AAGGATCCCCTTTGAGAGTCA Chr7:120531972..120531992 60.06 47.62
upstream ENSMUSE00000501392 Chr7:120529709..120529799 CACCGTGGCTAAAGTGATGA Chr7:120529761..120529780 59.72 50

*** Putative Vector Insertion (Chr 7: 120529593 - 120529708) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481017 Chr7:120529092..120529592 GGATTGCCATCAACAAGGAC Chr7:120529373..120529392 60.33 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCCGTGAGGTAAGTGCTG Chr7:120529697..120529717 60.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCCGTGAGGTAAGTGCTG Chr7:120529697..120529717 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059077