Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26248
Trapped Gene
BC043301 (ENSMUSG00000056592)
Vector Insertion
Chr 7: 50820214 - 50822637
Public Clones not available
Private Clones OST128558 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635148 (Chr7:50820009..50820213 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCAACCAGCTTCCAGTTCC Chr7:50820079..50820098 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635148 (Chr7:50820009..50820213 +)
Downstram Exon
ENSMUSE00000532754 (Chr7:50822638..50822764 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCAACCAGCTTCCAGTTCC Chr7:50820079..50820098 59.84 55 CAGGTGTCTCTGGACGGAGT Chr7:50822721..50822740 60.31 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675070 Chr7:50817626..50817791 AGCGGTCATATCCGCTTAAA Chr7:50817635..50817654 59.7 45
upstream ENSMUSE00000675069 Chr7:50819984..50820213 CTCAACCAGCTTCCAGTTCC Chr7:50820079..50820098 59.84 55
upstream ENSMUSE00000635148 Chr7:50820009..50820213 CTCAACCAGCTTCCAGTTCC Chr7:50820079..50820098 59.84 55

*** Putative Vector Insertion (Chr 7: 50820214 - 50822637) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532754 Chr7:50822638..50822764 CAGGTGTCTCTGGACGGAGT Chr7:50822721..50822740 60.31 60
downstream ENSMUSE00000532753 Chr7:50823015..50823113 TGACACCAACAAGGATGTGG Chr7:50823114..50823133 60.42 50
downstream ENSMUSE00000280424 Chr7:50827959..50830830 AGCTCGGACTTCTGGTTGAA Chr7:50829123..50829142 59.99 50
downstream ENSMUSE00000675067 Chr7:50827959..50830831 AGCTCGGACTTCTGGTTGAA Chr7:50829123..50829142 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGGTCCCGTGAGGTAAG Chr7:50820200..50820220 60.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGGTCCCGTGAGGTAAG Chr7:50820200..50820220 60.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056592