Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2625
Trapped Gene
Upf1 (ENSMUSG00000058301)
Vector Insertion
Chr 8: 72868265 - 72876676
Public Clones XR0413 (sanger) FHCRC-GT-S8-6D1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000508308 (Chr8:72876677..72877178 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGTTCGAATTCACCGACT Chr8:72876781..72876800 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000508308 (Chr8:72876677..72877178 -)
Downstram Exon
ENSMUSE00000507067 (Chr8:72868125..72868264 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGTTCGAATTCACCGACT Chr8:72876781..72876800 60.26 50 GGTCTTGGCCACACTGTCAT Chr8:72868186..72868205 61 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000508308 Chr8:72876677..72877178 CGAGTTCGAATTCACCGACT Chr8:72876781..72876800 60.26 50

*** Putative Vector Insertion (Chr 8: 72868265 - 72876676) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000507067 Chr8:72868125..72868264 GGTCTTGGCCACACTGTCAT Chr8:72868186..72868205 61 55
downstream ENSMUSE00000503574 Chr8:72867234..72867323 AAGTATTTCCTCGGCCATTG Chr8:72867219..72867238 59.04 45
downstream ENSMUSE00000510662 Chr8:72865909..72866076 CCTCACGAGGTGATTCACAA Chr8:72866030..72866049 59.68 50
downstream ENSMUSE00000507971 Chr8:72865359..72865539 CCTGCTCAGAGGGAATCTTG Chr8:72865399..72865418 59.94 55
downstream ENSMUSE00000517434 Chr8:72864449..72864610 TCCAGAGTGGCTGAAGGATT Chr8:72864566..72864585 59.8 50
downstream ENSMUSE00000514355 Chr8:72863881..72863998 GCAAAGTGAAGAAGGCGATT Chr8:72863907..72863926 59.46 45
downstream ENSMUSE00000511605 Chr8:72863642..72863740 TCAGGAACCTTGATGACGTG Chr8:72863622..72863641 59.68 50
downstream ENSMUSE00000516593 Chr8:72863223..72863331 GCGGAGCTCAATAGCAATCT Chr8:72863278..72863297 59.58 50
downstream ENSMUSE00000480446 Chr8:72862979..72863138 CCCAGCAGCTTGTGGTAAAT Chr8:72863042..72863061 60.13 50
downstream ENSMUSE00000485136 Chr8:72862785..72862903 GGATGAGGCTGAGTGGTCTC Chr8:72862836..72862855 59.8 60
downstream ENSMUSE00000482604 Chr8:72862296..72862460 GAGGCGTACGACCTTCAGTC Chr8:72862351..72862370 59.87 60
downstream ENSMUSE00000479641 Chr8:72862105..72862219 CTCTCTCAGCTGTGCGCTTA Chr8:72862094..72862113 59.64 55
downstream ENSMUSE00000484172 Chr8:72861388..72861531 CCAAGGACTACAGGCACCAT Chr8:72861376..72861395 59.99 55
downstream ENSMUSE00000490629 Chr8:72860916..72861129 GCAATGAGCCCTCGTAGAAG Chr8:72860912..72860931 59.98 55
downstream ENSMUSE00000486077 Chr8:72859553..72859670 GTGGCCACTGGAAGTCAAAG Chr8:72859610..72859629 60.69 55
downstream ENSMUSE00000483169 Chr8:72859132..72859288 TGCCTTCAACAGCTTCGTAGT Chr8:72859218..72859238 60.07 47.62
downstream ENSMUSE00000493592 Chr8:72858517..72858659 GGGTCGTTTAGGAACCCAAT Chr8:72858528..72858547 60.05 50
downstream ENSMUSE00000494397 Chr8:72857972..72858146 TTCCACTAGCGCCTTCTGTT Chr8:72858025..72858044 60.01 50
downstream ENSMUSE00000487755 Chr8:72857792..72857873 GGCATCGTACATGGCAGTAG Chr8:72857816..72857835 59.18 55
downstream ENSMUSE00000488514 Chr8:72857170..72857331 CTGTCCGAAGTAGCCAGGTG Chr8:72857167..72857186 60.84 60
downstream ENSMUSE00000497214 Chr8:72856872..72857089 CATGGACACGTAACCCTGTG Chr8:72856904..72856923 59.87 55
downstream ENSMUSE00000498109 Chr8:72856519..72856641 GAGTGCCACGTCAATCTGTG Chr8:72856572..72856591 60.32 55
downstream ENSMUSE00000491289 Chr8:72855432..72856378 GTGGCCTCTGAAGCTCAAAC Chr8:72855602..72855621 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr8:72870605..72870626 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCAGGAGACGGCTTTCCTA Chr8:72876690..72876710 59.43 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGAGCTGAACTTCGAGGAAGA Chr8:72871171..72871192 60.26 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGAGCTGAACTTCGAGGAAGA Chr8:72871171..72871192 60.26 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058301