Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26251
Trapped Gene
AC121108.12 (ENSMUSG00000027630)
Vector Insertion
Chr 3: 22087434 - 22088689
Public Clones not available
Private Clones OST128473 (lexicon) OST58671 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171326 (Chr3:22087288..22087433 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGCTGCACTCATCTCTAT Chr3:22087365..22087384 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171326 (Chr3:22087288..22087433 +)
Downstram Exon
ENSMUSE00000171318 (Chr3:22088690..22088912 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGCTGCACTCATCTCTAT Chr3:22087365..22087384 60.38 55 CTACATCGGGCATAACAGCA Chr3:22088762..22088781 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000428268 Chr3:21975706..21975876 CCTTAGTAACAGCTCCCCTCCT Chr3:21975706..21975727 60.14 54.54
upstream ENSMUSE00000305564 Chr3:22047864..22047930 TTGTGATTGGTGGTTGGCTA Chr3:22047874..22047893 59.96 45
upstream ENSMUSE00000392747 Chr3:22078125..22078227 CCTGTGTTGTGACCTCATGG Chr3:22078133..22078152 60 55
upstream ENSMUSE00000171326 Chr3:22087288..22087433 CCCGCTGCACTCATCTCTAT Chr3:22087365..22087384 60.38 55

*** Putative Vector Insertion (Chr 3: 22087434 - 22088689) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171318 Chr3:22088690..22088912 CTACATCGGGCATAACAGCA Chr3:22088762..22088781 59.71 50
downstream ENSMUSE00000171314 Chr3:22089837..22089969 AAGCACAACCGCTTTATTGG Chr3:22089907..22089926 60.13 45
downstream ENSMUSE00000171330 Chr3:22090314..22090455 CTCCTTCCCGTATGCAGTGT Chr3:22090411..22090430 60.13 55
downstream ENSMUSE00000171313 Chr3:22090942..22091005 TCCATATTCTGGCAAATCCA Chr3:22090999..22091018 58.92 40
downstream ENSMUSE00000171312 Chr3:22091092..22091189 CGCCAGCACTTAGGATGAAA Chr3:22091184..22091203 61.29 50
downstream ENSMUSE00000171324 Chr3:22092030..22092090 TGCTTGGCTTCACCAGTATG Chr3:22092073..22092092 59.86 50
downstream ENSMUSE00000171328 Chr3:22099242..22099363 TTGCTCTGCCAGTCAACATC Chr3:22099275..22099294 59.99 50
downstream ENSMUSE00000569264 Chr3:22099512..22099586 GTTGGGTCCCATTTGATAGC Chr3:22099546..22099565 59.25 50
downstream ENSMUSE00000569262 Chr3:22102019..22102146 TGGTCCTGTTGGACTCCACT Chr3:22102111..22102130 60.56 55
downstream ENSMUSE00000569261 Chr3:22102749..22102914 CACTGTACACGGGCTCTTGA Chr3:22102843..22102862 59.9 55
downstream ENSMUSE00000305477 Chr3:22108434..22108535 AGCACTGGCTCCAACTTTGT Chr3:22108526..22108545 59.91 50
downstream ENSMUSE00000427866 Chr3:22109323..22110890 GCTACTTAGGGGCACAGCAG Chr3:22109594..22109613 60.04 60
downstream ENSMUSE00000705945 Chr3:22109323..22110455 GCTACTTAGGGGCACAGCAG Chr3:22109594..22109613 60.04 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCAGAAAGGCCTGCAGTAT Chr3:22087388..22087408 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGAAAGGCCTGCAGTAT Chr3:22087388..22087408 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027630