Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26266
Trapped Gene
Dnajc2 (ENSMUSG00000029014)
Vector Insertion
Chr 5: 21280894 - 21282534
Public Clones (ggtc)
Private Clones OST127662 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000267556 (Chr5:21282535..21282633 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCAGACAAACGGAAAGC Chr5:21282591..21282610 60.64 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000267556 (Chr5:21282535..21282633 -)
Downstram Exon
ENSMUSE00000702003 (Chr5:21280325..21280893 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCAGACAAACGGAAAGC Chr5:21282591..21282610 60.64 50 AGCTTTCTGCAAGCGTGAAT Chr5:21280477..21280496 60.16 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702006 Chr5:21290807..21291003 AGGCTCAGACCACAGGTAGTG Chr5:21290936..21290956 59.38 57.14
upstream ENSMUSE00000702014 Chr5:21290807..21291002 AGGCTCAGACCACAGGTAGTG Chr5:21290936..21290956 59.38 57.14
upstream ENSMUSE00000702021 Chr5:21290807..21291034 AGTGCTCACTGGTCGTCTCC Chr5:21290991..21291010 60.47 60
upstream ENSMUSE00000718115 Chr5:21290807..21291003 AGGCTCAGACCACAGGTAGTG Chr5:21290936..21290956 59.38 57.14
upstream ENSMUSE00000184491 Chr5:21288865..21289055 CCCATGCTGAAAACACTTGA Chr5:21288881..21288900 59.69 45
upstream ENSMUSE00000702020 Chr5:21288865..21288966 CCCATGCTGAAAACACTTGA Chr5:21288881..21288900 59.69 45
upstream ENSMUSE00000184499 Chr5:21287139..21287214 No primer for this exon
upstream ENSMUSE00000267556 Chr5:21282535..21282633 CATCCAGACAAACGGAAAGC Chr5:21282591..21282610 60.64 50

*** Putative Vector Insertion (Chr 5: 21280894 - 21282534) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000267550 Chr5:21280752..21280893 TAAATGCCCGCCTTTTCACT Chr5:21280830..21280849 61.82 45
downstream ENSMUSE00000702003 Chr5:21280325..21280893 AGCTTTCTGCAAGCGTGAAT Chr5:21280477..21280496 60.16 45
downstream ENSMUSE00000267542 Chr5:21279596..21279676 No primer for this exon
downstream ENSMUSE00000183594 Chr5:21276303..21276368 No primer for this exon
downstream ENSMUSE00000183599 Chr5:21274464..21274555 CTCGTGGCTCTGTTCTGCTT Chr5:21274489..21274508 60.73 55
downstream ENSMUSE00000183591 Chr5:21274255..21274376 CTGCTTCTTTCTTGGCCTTTT Chr5:21274286..21274306 60.01 42.86
downstream ENSMUSE00000183588 Chr5:21272374..21272523 TAGCCAACCGAACAGCTTCT Chr5:21272465..21272484 60.01 50
downstream ENSMUSE00000183598 Chr5:21269559..21269647 GCCGATCACAGAGTTTTTCC Chr5:21269550..21269569 59.68 50
downstream ENSMUSE00000183590 Chr5:21269264..21269333 ATTTCATTCAAGCCCTGCAA Chr5:21269291..21269310 60.58 40
downstream ENSMUSE00000183586 Chr5:21267359..21267543 CACTCCCACTTCCACCAGTT Chr5:21267416..21267435 60 55
downstream ENSMUSE00000267484 Chr5:21266444..21266544 TTTGGAGGCTTTTAGCCTTG Chr5:21266428..21266447 59.47 45
downstream ENSMUSE00000267476 Chr5:21266184..21266291 TTCAAACCGTTCTGATGGTG Chr5:21266163..21266182 59.54 45
downstream ENSMUSE00000267468 Chr5:21263583..21263737 GCCTCATGCAGTCCTTCTTC Chr5:21263569..21263588 59.96 55
downstream ENSMUSE00000267460 Chr5:21263100..21263227 CCAGGATTGCCTGCATTATT Chr5:21263116..21263135 59.92 45
downstream ENSMUSE00000702013 Chr5:21263090..21263737 GCCTCATGCAGTCCTTCTTC Chr5:21263569..21263588 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTGTTAATCGCCTTGCAG Chr5:21282469..21282489 59.87 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCGTGACTGGGAAAACC Chr5:21282467..21282487 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029014