Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26275
Trapped Gene
F2r (ENSMUSG00000048376)
Vector Insertion
Chr 13: 96374893 - 96388241
Public Clones (sanger)
Private Clones OST127345 (lexicon) OST60521 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000353700 (Chr13:96388242..96388414 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGACCGAGCTACTCAGAAA Chr13:96388377..96388396 60.53 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000353700 (Chr13:96388242..96388414 -)
Downstram Exon
ENSMUSE00000340298 (Chr13:96371759..96374892 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGACCGAGCTACTCAGAAA Chr13:96388377..96388396 60.53 55 GACTTTCGTGGAAGCGACTC Chr13:96371905..96371924 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353700 Chr13:96388242..96388414 CCGACCGAGCTACTCAGAAA Chr13:96388377..96388396 60.53 55

*** Putative Vector Insertion (Chr 13: 96374893 - 96388241) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000340298 Chr13:96371759..96374892 GACTTTCGTGGAAGCGACTC Chr13:96371905..96371924 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGGGGGAAGCTATCAGAA Chr13:96379198..96379218 60.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGGGGGAAGCTATCAGAA Chr13:96379198..96379218 60.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr13:96373345..96373365 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TAAGGACCTTCAGCCGTGAC Chr13:96373358..96373378 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048376