Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26282
Trapped Gene
2410003J06Rik (ENSMUSG00000046942)
Vector Insertion
Chr X: 76887128 - 76916621
Public Clones 5SE305D02 (ggtc) IST14134H9 (tigm)
Private Clones OST126947 (lexicon) OST102620 (lexicon) OST51016 (lexicon) OST37055 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000623253 (ChrX:76916622..76916774 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTAGCGCTCTCAACTCAG ChrX:76916685..76916704 60.29 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000623253 (ChrX:76916622..76916774 -)
Downstram Exon
ENSMUSE00000623252 (ChrX:76887060..76887127 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTAGCGCTCTCAACTCAG ChrX:76916685..76916704 60.29 60 TATCTTTCTCCGCCAACGTC ChrX:76887062..76887081 60.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000623253 ChrX:76916622..76916774 CCCTAGCGCTCTCAACTCAG ChrX:76916685..76916704 60.29 60

*** Putative Vector Insertion (Chr X: 76887128 - 76916621) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000623252 ChrX:76887060..76887127 TATCTTTCTCCGCCAACGTC ChrX:76887062..76887081 60.21 50
downstream ENSMUSE00000697772 ChrX:76880830..76880894 CTTCAGCGGCTTTTCAACAA ChrX:76880846..76880865 61.43 45
downstream ENSMUSE00000623251 ChrX:76873180..76873259 TCCTGAGAGCACCTCCTTTG ChrX:76873164..76873183 60.52 55
downstream ENSMUSE00000654835 ChrX:76869557..76870117 GGAACATGGCTCCTCAACAT ChrX:76869988..76870007 59.93 50
downstream ENSMUSE00000654834 ChrX:76869454..76869513 GTACTCATCATTGCGCATCC ChrX:76869457..76869476 59.11 50
downstream ENSMUSE00000470817 ChrX:76868572..76870122 CATCTTTCCCCGCAAGTTTA ChrX:76868939..76868958 60.07 45
downstream ENSMUSE00000697770 ChrX:76868570..76870122 CATCTTTCCCCGCAAGTTTA ChrX:76868939..76868958 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGAAGGATAATCGCCTTG ChrX:76901559..76901579 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGACGTGACTGGGAAAA ChrX:76901556..76901576 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT ChrX:76892705..76892725 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGAAATGTAAAAATGTGGGAAAAT ChrX:76892755..76892779 58.76 25 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046942