Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26288
Trapped Gene
Zcchc8 (ENSMUSG00000029427)
Vector Insertion
Chr 5: 124167068 - 124169500
Public Clones (sanger)
Private Clones OST126815 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326250 (Chr5:124169501..124169541 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326250 (Chr5:124169501..124169541 -)
Downstram Exon
ENSMUSE00000326239 (Chr5:124166993..124167067 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000326258 Chr5:124170730..124170949 GTGGATTTTGGCGACCTAGA Chr5:124170908..124170927 60.07 50
upstream ENSMUSE00000326250 Chr5:124169501..124169541 No primer for this exon

*** Putative Vector Insertion (Chr 5: 124167068 - 124169500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000326239 Chr5:124166993..124167067 No primer for this exon
downstream ENSMUSE00000326234 Chr5:124164634..124164739 GGGGTAAAAGGCTGAAGGAA Chr5:124164614..124164633 60.42 50
downstream ENSMUSE00000326228 Chr5:124164075..124164152 TTAACGGCACATGATTCTTCC Chr5:124164075..124164095 59.95 42.86
downstream ENSMUSE00000326221 Chr5:124159391..124159494 CCATCCTTCCGTAAGCTGAG Chr5:124159380..124159399 59.83 55
downstream ENSMUSE00000326216 Chr5:124159204..124159269 CTTGCATCTCTTGCCCTTCT Chr5:124159195..124159214 59.57 50
downstream ENSMUSE00000326211 Chr5:124158581..124158641 CATTGGGCATTCCTTCATCT Chr5:124158559..124158578 59.89 45
downstream ENSMUSE00000326204 Chr5:124158001..124158143 CCTGGCTTGAATCTTCCAAA Chr5:124157988..124158007 60.18 45
downstream ENSMUSE00000326196 Chr5:124157278..124157420 TGTCACACCCAGTGCATCTT Chr5:124157368..124157387 60.16 50
downstream ENSMUSE00000188808 Chr5:124154532..124154650 GTTTCTGTTTCCCCATCAGC Chr5:124154604..124154623 59.53 50
downstream ENSMUSE00000326178 Chr5:124153002..124153088 GCATTGGTATGGAACCGAAC Chr5:124153036..124153055 60.2 50
downstream ENSMUSE00000326165 Chr5:124152572..124152689 CTTTCGCTGCTTCTTTGGAC Chr5:124152596..124152615 60.13 50
downstream ENSMUSE00000326156 Chr5:124149808..124151131 GGAACATCTGAGTCGCCATT Chr5:124150821..124150840 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCTCTCCTTCTCTCGTG Chr5:124169445..124169465 60.67 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 2 CAAGACCCAGGTATGACACG Chr5:124169489..124169509 59.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029427