Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26291
Trapped Gene
Zfp71-rs1 (ENSMUSG00000071281)
Vector Insertion
Chr 13: 67811945 - 67829997
Public Clones IST11785F9 (tigm) IST11580G10 (tigm)
Private Clones OST126792 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681337 (Chr13:67829998..67830019 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681337 (Chr13:67829998..67830019 -)
Downstram Exon
ENSMUSE00000540445 (Chr13:67811818..67811944 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACCTAGGCATTCCCACTCCT Chr13:67811860..67811879 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681337 Chr13:67829998..67830019 No primer for this exon

*** Putative Vector Insertion (Chr 13: 67811945 - 67829997) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000540445 Chr13:67811818..67811944 ACCTAGGCATTCCCACTCCT Chr13:67811860..67811879 59.96 55
downstream ENSMUSE00000641321 Chr13:67811252..67811347 TGGAGCTCCTCCTCTTTTCA Chr13:67811243..67811262 60.06 50
downstream ENSMUSE00000681336 Chr13:67806246..67809866 CCCTAAATGCGGAGAACAAA Chr13:67806419..67806438 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTAATCGCCTTGCAGCAC Chr13:67817929..67817949 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGACGTGACTGGGAAAAC Chr13:67829931..67829951 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATCCCTGACATGGAGGTTG Chr13:67829992..67830012 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GATCCCTGACATGGAGGTTG Chr13:67829992..67830012 60.33 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071281