Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2633
Trapped Gene
Coro1c (ENSMUSG00000004530)
Vector Insertion
Chr 5: 114315771 - 114331966
Public Clones (sanger) XP0266 (sanger) (sanger) XR1012 (sanger) (sanger)
RRN126 (baygenomics)
Private Clones OST446459 (lexicon) OST383197 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000476005 (Chr5:114331967..114332166 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000476005 (Chr5:114331967..114332166 -)
Downstram Exon
ENSMUSE00000540021 (Chr5:114315648..114315770 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000506568 Chr5:114358620..114358715 No primer for this exon
upstream ENSMUSE00000476005 Chr5:114331967..114332166 No primer for this exon

*** Putative Vector Insertion (Chr 5: 114315771 - 114331966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000540021 Chr5:114315648..114315770 No primer for this exon
downstream ENSMUSE00000540020 Chr5:114302180..114302309 No primer for this exon
downstream ENSMUSE00000190497 Chr5:114300660..114300841 No primer for this exon
downstream ENSMUSE00000190499 Chr5:114299538..114299657 No primer for this exon
downstream ENSMUSE00000190495 Chr5:114298536..114298640 No primer for this exon
downstream ENSMUSE00000540019 Chr5:114297443..114297588 No primer for this exon
downstream ENSMUSE00000540018 Chr5:114296155..114296212 No primer for this exon
downstream ENSMUSE00000190502 Chr5:114295170..114295415 No primer for this exon
downstream ENSMUSE00000274317 Chr5:114292448..114294477 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTTCTGGAGCTGGAGATAC Chr5:114316924..114316945 60.22 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGACCGTGACTGGGAAAA Chr5:114316901..114316921 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCAGCAGACAAGCTCTGACA Chr5:114329116..114329136 60.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCACTGTAAGCACTCGTGA Chr5:114317111..114317131 60.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004530