Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26340
Trapped Gene
Gltp (ENSMUSG00000011884)
Vector Insertion
Chr 5: 115126344 - 115126408
Public Clones not available
Private Clones OST124229 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690800 (Chr5:115126345..115126407 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690800 (Chr5:115126345..115126407 -)
Downstram Exon
ENSMUSE00000690793 (Chr5:115126331..115126407 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427764 Chr5:115140768..115140950 No primer for this exon
upstream ENSMUSE00000690794 Chr5:115140768..115140917 No primer for this exon
upstream ENSMUSE00000690806 Chr5:115140768..115140930 No primer for this exon
upstream ENSMUSE00000190151 Chr5:115127630..115127688 No primer for this exon
upstream ENSMUSE00000690800 Chr5:115126345..115126407 No primer for this exon

*** Putative Vector Insertion (Chr 5: 115126344 - 115126408) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690793 Chr5:115126331..115126407 No primer for this exon
downstream ENSMUSE00000190154 Chr5:115126274..115126407 No primer for this exon
downstream ENSMUSE00000190157 Chr5:115124063..115124213 No primer for this exon
downstream ENSMUSE00000690799 Chr5:115124063..115124194 No primer for this exon
downstream ENSMUSE00000690792 Chr5:115120237..115120598 No primer for this exon
downstream ENSMUSE00000690797 Chr5:115120092..115120598 No primer for this exon
downstream ENSMUSE00000351459 Chr5:115119415..115120598 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCCAGCCAAGTTCAAGAC Chr5:115126362..115126382 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCCAGCCAAGTTCAAGAC Chr5:115126362..115126382 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011884