Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26349
Trapped Gene
BC010304 (ENSMUSG00000038014)
Vector Insertion
Chr 13: 49041394 - 49044425
Public Clones not available
Private Clones OST123911 (lexicon) OST41694 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454432 (Chr13:49044426..49044672 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATCTGATGCACGAGGTTGC Chr13:49044479..49044498 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454432 (Chr13:49044426..49044672 -)
Downstram Exon
ENSMUSE00000454412 (Chr13:49041311..49041393 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATCTGATGCACGAGGTTGC Chr13:49044479..49044498 59.83 50 CTTCAGTGAGGCGAGTGGAT Chr13:49041289..49041308 60.41 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000571043 Chr13:49062724..49063386 GTGGCTTCTACACCGACTGG Chr13:49063003..49063022 60.71 60
upstream ENSMUSE00000454432 Chr13:49044426..49044672 TATCTGATGCACGAGGTTGC Chr13:49044479..49044498 59.83 50

*** Putative Vector Insertion (Chr 13: 49041394 - 49044425) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000454412 Chr13:49041311..49041393 CTTCAGTGAGGCGAGTGGAT Chr13:49041289..49041308 60.41 55
downstream ENSMUSE00000454406 Chr13:49029319..49029447 AGCTATGGCATCCAGGTCAG Chr13:49029321..49029340 60.24 55
downstream ENSMUSE00000276582 Chr13:49027666..49027762 TAATGTGGTGGGTGAAATGG Chr13:49027649..49027668 59.1 45
downstream ENSMUSE00000276573 Chr13:49017522..49017619 AGCATCTGAGGGGGAACATA Chr13:49017537..49017556 59.51 50
downstream ENSMUSE00000276565 Chr13:49017051..49017334 GTTCTTCCCGCTAGTGTCCA Chr13:49017214..49017233 60.26 55
downstream ENSMUSE00000276556 Chr13:49010231..49010318 TCTCCCAGCCAATCTTGTTC Chr13:49010265..49010284 60.19 50
downstream ENSMUSE00000276547 Chr13:49008226..49008453 TGCTCAGCCACTCTCAACAC Chr13:49008256..49008275 60.19 55
downstream ENSMUSE00000276537 Chr13:49005625..49005799 CAGGTCTTTGTTGGCTTCATC Chr13:49005727..49005747 59.73 47.62
downstream ENSMUSE00000276529 Chr13:48997427..48997676 CACTAGTTCCGGGGTCTGAG Chr13:48997587..48997606 59.72 60
downstream ENSMUSE00000276520 Chr13:48993029..48993143 TGGTCCGGCTCATAGAGTTT Chr13:48993023..48993042 59.69 50
downstream ENSMUSE00000149346 Chr13:48987250..48987459 TCACAGAGGTCGATGAGTGG Chr13:48987235..48987254 59.82 55
downstream ENSMUSE00000276504 Chr13:48985124..48985307 GTGCCGAGGGTATACAGAGG Chr13:48985148..48985167 59.57 60
downstream ENSMUSE00000276495 Chr13:48984493..48984630 GGGCCTGTTGCTACTGTTTC Chr13:48984560..48984579 59.74 55
downstream ENSMUSE00000276486 Chr13:48981106..48981247 TCTAGCTTCCCTCCCTGAGA Chr13:48981189..48981208 59.11 55
downstream ENSMUSE00000276478 Chr13:48980642..48980738 TGGAAATAACACCCCTTGGA Chr13:48980694..48980713 60.16 45
downstream ENSMUSE00000377549 Chr13:48974585..48976464 GGACTTGGATTCCCCAGATT Chr13:48976368..48976387 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAACCCAAATCGTTTTCCT Chr13:49041443..49041463 59.41 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACCCAAATCGTTTTCCT Chr13:49041443..49041463 59.41 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038014