Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26356
Trapped Gene
Plxnb1 (ENSMUSG00000053646)
Vector Insertion
Chr 9: 108998160 - 109001784
Public Clones (sanger)
Private Clones OST123562 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000475459 (Chr9:108998106..108998159 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000475459 (Chr9:108998106..108998159 +)
Downstram Exon
ENSMUSE00000481480 (Chr9:109001785..109001837 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCATGACCTGAGCAGGAGTC Chr9:109001809..109001828 60.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000475459 Chr9:108998106..108998159 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108998160 - 109001784) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481480 Chr9:109001785..109001837 GCATGACCTGAGCAGGAGTC Chr9:109001809..109001828 60.99 60
downstream ENSMUSE00000479504 Chr9:109002586..109003698 GAAGGCACACTCGAGACACA Chr9:109003354..109003373 60.03 55
downstream ENSMUSE00000466155 Chr9:109004535..109004717 ACCCCTGGTAGCTCCAGAAT Chr9:109004638..109004657 59.96 55
downstream ENSMUSE00000472273 Chr9:109005088..109005216 ATATGGGGCAGCACTTCTTC Chr9:109005126..109005145 59.15 50
downstream ENSMUSE00000462527 Chr9:109005341..109005441 CACACACCATCCGCAATAAG Chr9:109005433..109005452 59.99 50
downstream ENSMUSE00000517580 Chr9:109005729..109005861 CACTCGAAGACAGCCCAGTT Chr9:109005819..109005838 60.44 55
downstream ENSMUSE00000520660 Chr9:109006127..109006283 GAGGGACACATCACACCAGA Chr9:109006245..109006264 59.5 55
downstream ENSMUSE00000516843 Chr9:109006542..109006650 AGATGGGGAAGACGCAGTAA Chr9:109006648..109006667 59.69 50
downstream ENSMUSE00000509421 Chr9:109006737..109006845 CTGTTGGCTTGCCACCATAG Chr9:109006848..109006867 61.62 55
downstream ENSMUSE00000506740 Chr9:109007248..109007922 AAGCTGTTGGGGGTAGGAGT Chr9:109007348..109007367 59.99 55
downstream ENSMUSE00000508532 Chr9:109008105..109008227 GTTCCACATGGACCGGTATC Chr9:109008189..109008208 60.06 55
downstream ENSMUSE00000495530 Chr9:109008430..109008552 CACTTGATGTGGCACCAGAC Chr9:109008542..109008561 60.16 55
downstream ENSMUSE00000498124 Chr9:109008775..109008868 ACCTGCAGTTCTGGCTTCAA Chr9:109008812..109008831 60.97 50
downstream ENSMUSE00000497309 Chr9:109008955..109009127 TCGGCTTCATTACAGGCTTC Chr9:109009090..109009109 60.35 50
downstream ENSMUSE00000500419 Chr9:109009274..109009425 TTGGAGCCCCTGATAGTGAC Chr9:109009335..109009354 60.07 55
downstream ENSMUSE00000505313 Chr9:109010635..109010740 ACAGTGCCAGTCACCTCCTC Chr9:109010685..109010704 60.31 60
downstream ENSMUSE00000502216 Chr9:109010921..109011057 TGTCCTCTAGCCGTCCAGTC Chr9:109011026..109011045 60.41 60
downstream ENSMUSE00000501408 Chr9:109011313..109011489 ATACTTGAATTGGCCGTGCT Chr9:109011442..109011461 59.6 45
downstream ENSMUSE00000487963 Chr9:109011682..109011811 GACCACGTGTTGCTTCTGTG Chr9:109011805..109011824 60.36 55
downstream ENSMUSE00000487157 Chr9:109012004..109012246 GTGGGAGGAGTTCACGAGAC Chr9:109012039..109012058 59.69 60
downstream ENSMUSE00000489816 Chr9:109012864..109013040 TCCGGGTCAGTGTCTTTACC Chr9:109012954..109012973 59.97 55
downstream ENSMUSE00000489007 Chr9:109013117..109013265 CCATCGTACTGCACATGACC Chr9:109013169..109013188 59.99 55
downstream ENSMUSE00000492105 Chr9:109013972..109014072 CACTGCTCTCCAGGTTCTCC Chr9:109014045..109014064 59.99 60
downstream ENSMUSE00000491359 Chr9:109014161..109014378 AGTCAAGGAAGGGGATACCG Chr9:109014229..109014248 60.32 55
downstream ENSMUSE00000493242 Chr9:109014475..109014653 CCGTGAAGTGCAACAGTGAG Chr9:109014563..109014582 60.5 55
downstream ENSMUSE00000529525 Chr9:109014777..109014843 ATCCAGTTGGTGAGCAGCTT Chr9:109014818..109014837 59.87 50
downstream ENSMUSE00000486846 Chr9:109015019..109015165 CAAGGGACGGTACTCCACAT Chr9:109015168..109015187 59.84 55
downstream ENSMUSE00000490641 Chr9:109015798..109015966 GCAAGAGGCACTCCCTTGTA Chr9:109015937..109015956 60.4 55
downstream ENSMUSE00000471802 Chr9:109016155..109016258 TGTATTCAGACGCCTCCACA Chr9:109016246..109016265 60.26 50
downstream ENSMUSE00000478556 Chr9:109016334..109016418 GTTCCCCAGGGACATAATCC Chr9:109016421..109016440 60.39 55
downstream ENSMUSE00000443318 Chr9:109016762..109016934 CTGGTTCATCACTCGGCTTT Chr9:109016839..109016858 60.26 50
downstream ENSMUSE00000529519 Chr9:109017091..109017251 ACCTGGAACAGGTCATCCAC Chr9:109017131..109017150 59.82 55
downstream ENSMUSE00000475951 Chr9:109017337..109017484 TGCACATCGAACACAAACTG Chr9:109017399..109017418 59.3 45
downstream ENSMUSE00000482627 Chr9:109018021..109018085 No primer for this exon
downstream ENSMUSE00000471425 Chr9:109018209..109018284 TCCGCCAAGACTGAGTTCAT Chr9:109018277..109018296 60.8 50
downstream ENSMUSE00000470506 Chr9:109019097..109019171 No primer for this exon
downstream ENSMUSE00000465562 Chr9:109020354..109022422 GTGACTCAGAGCACGTTCCA Chr9:109022360..109022379 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGGTGGAGATTTGTATGA Chr9:109001176..109001196 59.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGGTGGAGATTTGTATGA Chr9:109001176..109001196 59.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053646