Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26366
Trapped Gene
Slamf9 (ENSMUSG00000026548)
Vector Insertion
Chr 1: 174405671 - 174406263
Public Clones not available
Private Clones OST123070 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000160386 (Chr1:174405505..174405670 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTCTATGGACCCCTTACC Chr1:174405545..174405564 59.79 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000160386 (Chr1:174405505..174405670 +)
Downstram Exon
ENSMUSE00000160384 (Chr1:174406264..174406605 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTCTATGGACCCCTTACC Chr1:174405545..174405564 59.79 60 TTCACGATGGCAATGTTGTT Chr1:174406411..174406430 59.97 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000160386 Chr1:174405505..174405670 GCCTCTATGGACCCCTTACC Chr1:174405545..174405564 59.79 60

*** Putative Vector Insertion (Chr 1: 174405671 - 174406263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160384 Chr1:174406264..174406605 TTCACGATGGCAATGTTGTT Chr1:174406411..174406430 59.97 40
downstream ENSMUSE00000160387 Chr1:174407337..174407609 GAGCCTTCATGGGATGTGTT Chr1:174407496..174407515 59.93 50
downstream ENSMUSE00000400670 Chr1:174408191..174408706 TTGAGTTTCCTCACCCTTGG Chr1:174408338..174408357 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTTCTGTGGTCACTCCTG Chr1:174405636..174405656 60.7 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTTCTGTGGTCACTCCTG Chr1:174405636..174405656 60.7 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026548