Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26375
Trapped Gene
Hnrnpul1 (ENSMUSG00000040725)
Vector Insertion
Chr 7: 26533496 - 26535883
Public Clones not available
Private Clones OST122621 (lexicon) OST101133 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313197 (Chr7:26535884..26536009 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGACACCAGTCATCAAGC Chr7:26535953..26535972 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313197 (Chr7:26535884..26536009 -)
Downstram Exon
ENSMUSE00000313188 (Chr7:26533342..26533495 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGACACCAGTCATCAAGC Chr7:26535953..26535972 59.42 55 AAAGGGCCTCTTTCGATTCT Chr7:26533367..26533386 59.31 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000457808 Chr7:26539360..26539720 ACAACAACGAGGAGGTCGAG Chr7:26539460..26539479 60.3 55
upstream ENSMUSE00000676624 Chr7:26539360..26539749 GGTTACCTGGGCACAACAAC Chr7:26539472..26539491 60.28 55
upstream ENSMUSE00000313197 Chr7:26535884..26536009 CGAGACACCAGTCATCAAGC Chr7:26535953..26535972 59.42 55

*** Putative Vector Insertion (Chr 7: 26533496 - 26535883) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000313188 Chr7:26533342..26533495 AAAGGGCCTCTTTCGATTCT Chr7:26533367..26533386 59.31 45
downstream ENSMUSE00000313182 Chr7:26531367..26531440 TGGCCACAAGTGTATCATCA Chr7:26531354..26531373 58.49 45
downstream ENSMUSE00000313175 Chr7:26530112..26530251 CAAAGCCCTCAATCGTCAAT Chr7:26530158..26530177 60.07 45
downstream ENSMUSE00000313167 Chr7:26527946..26528045 GTCGGGCTCTGTAGATGGAA Chr7:26527976..26527995 60.22 55
downstream ENSMUSE00000313159 Chr7:26525847..26525959 TTTTCAAAGCGGCTATTGGT Chr7:26525871..26525890 59.72 40
downstream ENSMUSE00000676620 Chr7:26521616..26521780 GGGAAAGAAAGATGCACAGG Chr7:26521651..26521670 59.67 50
downstream ENSMUSE00000313151 Chr7:26519578..26519844 CATGAGGATAGAGGGCCTGA Chr7:26519708..26519727 60.17 55
downstream ENSMUSE00000313143 Chr7:26518263..26518385 GATGGCATTGGTACCCAGAA Chr7:26518256..26518275 60.72 50
downstream ENSMUSE00000313137 Chr7:26518035..26518163 AAGACGGTTGAGGCACTGAG Chr7:26518058..26518077 60.44 55
downstream ENSMUSE00000313129 Chr7:26511754..26511922 GTCTCTGGGCTGACCCATAA Chr7:26511873..26511892 60.07 55
downstream ENSMUSE00000313124 Chr7:26510943..26511233 TCGTTGTATTGCCTCACCAG Chr7:26511112..26511131 59.72 50
downstream ENSMUSE00000313118 Chr7:26509574..26509863 CCTCGGTTGTTGGAGTTGTT Chr7:26509757..26509776 60.01 50
downstream ENSMUSE00000313111 Chr7:26507825..26508016 GGGCCATAGCTCCCATAGTT Chr7:26507885..26507904 60.31 55
downstream ENSMUSE00000395476 Chr7:26506517..26507382 TCCAACTGAACAGACGCTTG Chr7:26506535..26506554 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGACATGGAGCCACAGCAG Chr7:26535898..26535918 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGACATGGAGCCACAGCAG Chr7:26535898..26535918 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040725