Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26391
Trapped Gene
Sec14l1 (ENSMUSG00000020823)
Vector Insertion
Chr 11: 117002882 - 117002975
Public Clones not available
Private Clones OST121430 (lexicon) OST42574 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000109612 (Chr11:117002732..117002881 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000109612 (Chr11:117002732..117002881 +)
Downstram Exon
ENSMUSE00000109632 (Chr11:117002976..117003107 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000645924 Chr11:116976552..116976665 No primer for this exon
upstream ENSMUSE00000430293 Chr11:116978474..116978566 No primer for this exon
upstream ENSMUSE00000707550 Chr11:116978474..116978566 No primer for this exon
upstream ENSMUSE00000109612 Chr11:117002732..117002881 No primer for this exon

*** Putative Vector Insertion (Chr 11: 117002882 - 117002975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109632 Chr11:117002976..117003107 No primer for this exon
downstream ENSMUSE00000109635 Chr11:117004601..117004729 No primer for this exon
downstream ENSMUSE00000669592 Chr11:117005095..117005329 No primer for this exon
downstream ENSMUSE00000645939 Chr11:117006163..117006272 No primer for this exon
downstream ENSMUSE00000645937 Chr11:117008422..117008611 No primer for this exon
downstream ENSMUSE00000645936 Chr11:117009849..117009937 No primer for this exon
downstream ENSMUSE00000645935 Chr11:117010460..117010530 No primer for this exon
downstream ENSMUSE00000645934 Chr11:117011473..117011644 No primer for this exon
downstream ENSMUSE00000645933 Chr11:117011918..117012052 No primer for this exon
downstream ENSMUSE00000645931 Chr11:117014458..117014592 No primer for this exon
downstream ENSMUSE00000645929 Chr11:117016534..117016785 No primer for this exon
downstream ENSMUSE00000645928 Chr11:117017675..117017853 No primer for this exon
downstream ENSMUSE00000661061 Chr11:117018115..117018216 No primer for this exon
downstream ENSMUSE00000712516 Chr11:117018115..117020582 No primer for this exon
downstream ENSMUSE00000645926 Chr11:117018573..117018873 No primer for this exon
downstream ENSMUSE00000645919 Chr11:117020068..117020083 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAGCTGGGGAAACTGTG Chr11:117002881..117002901 59.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTAGCTGGGGAAACTGTG Chr11:117002881..117002901 59.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020823