Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26394
Trapped Gene
Dzip1 (ENSMUSG00000042156)
Vector Insertion
Chr 14: 119323741 - 119324362
Public Clones not available
Private Clones OST121219 (lexicon) OST107003 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000685110 (Chr14:119324363..119324609 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGACCAGACACGCTTTATC Chr14:119324523..119324542 60.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000685110 (Chr14:119324363..119324609 -)
Downstram Exon
ENSMUSE00000685111 (Chr14:119323647..119323740 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGACCAGACACGCTTTATC Chr14:119324523..119324542 60.66 55 CTGGCAGGTTTGTGGATTCT Chr14:119323625..119323644 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685110 Chr14:119324363..119324609 CGGACCAGACACGCTTTATC Chr14:119324523..119324542 60.66 55

*** Putative Vector Insertion (Chr 14: 119323741 - 119324362) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000685111 Chr14:119323647..119323740 CTGGCAGGTTTGTGGATTCT Chr14:119323625..119323644 60.11 50
downstream ENSMUSE00000552398 Chr14:119322133..119322389 CACTCTCCTCGTGAGCCTCT Chr14:119322203..119322222 59.73 60
downstream ENSMUSE00000646867 Chr14:119321465..119322013 TAGCTGCGAGGTGAGGAACT Chr14:119321614..119321633 60.16 55
downstream ENSMUSE00000646866 Chr14:119314412..119314496 GCTTTGTAGGAACGCTTGGT Chr14:119314427..119314446 59.38 50
downstream ENSMUSE00000646865 Chr14:119311664..119311788 CGGTCTGGGCCTTTGTATTA Chr14:119311743..119311762 59.95 50
downstream ENSMUSE00000646864 Chr14:119310564..119310725 CCCTCATAAACATCCCCTTG Chr14:119310583..119310602 59.24 50
downstream ENSMUSE00000646863 Chr14:119308656..119308793 CTGGCTGTCAAGCAGCTGTA Chr14:119308634..119308653 60.35 55
downstream ENSMUSE00000646882 Chr14:119308656..119308790 CTGGCTGTCAAGCAGCTGTA Chr14:119308634..119308653 60.35 55
downstream ENSMUSE00000646862 Chr14:119306117..119306179 TCGATCTGTCCACTTGCTTG Chr14:119306137..119306156 59.98 50
downstream ENSMUSE00000646861 Chr14:119301237..119301377 TTCTGCTCCTGCAGTTTCTG Chr14:119301243..119301262 59.31 50
downstream ENSMUSE00000646860 Chr14:119300723..119300771 GCTGATGCTGCTGTATGGTTT Chr14:119300711..119300731 60.29 47.62
downstream ENSMUSE00000646859 Chr14:119299208..119299264 CAGCCGATTTAGGTTCCAGT Chr14:119299201..119299220 59.19 50
downstream ENSMUSE00000646858 Chr14:119295073..119295129 GTACCATGGTCAGGCTGGAT Chr14:119295054..119295073 59.81 55
downstream ENSMUSE00000646857 Chr14:119290992..119291054 No primer for this exon
downstream ENSMUSE00000646856 Chr14:119288478..119288614 CGCTCCAGGTTAGTCCTCAG Chr14:119288496..119288515 60.01 60
downstream ENSMUSE00000646855 Chr14:119286290..119286452 ATTCTCGGATTTGCTGGATG Chr14:119286322..119286341 60.04 45
downstream ENSMUSE00000646854 Chr14:119285720..119285849 ACTTCTTCGGGTGGAAAGGT Chr14:119285782..119285801 59.97 50
downstream ENSMUSE00000646853 Chr14:119284828..119284881 GGTGGATGGAAACCTTCTGA Chr14:119284808..119284827 59.9 50
downstream ENSMUSE00000646851 Chr14:119282587..119282789 TCCAGTCCGTGTCACTTTTG Chr14:119282613..119282632 59.72 50
downstream ENSMUSE00000646849 Chr14:119280232..119280362 CCCACTTCCTTGGGGTAAAG Chr14:119280279..119280298 60.7 55
downstream ENSMUSE00000685109 Chr14:119279991..119280077 TTGTTCAGTCCACACCTGCT Chr14:119279988..119280007 59.31 50
downstream ENSMUSE00000646848 Chr14:119278566..119278734 ATCCCAGTCCTCGTCATCAG Chr14:119278683..119278702 60.07 55
downstream ENSMUSE00000646847 Chr14:119275483..119276484 GACATCGCTCCAGTCAGTCA Chr14:119276395..119276414 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGCCGAGGTCTAGGATG Chr14:119324341..119324361 59.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGCCGAGGTCTAGGATG Chr14:119324341..119324361 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042156