Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2640
Trapped Gene
Klhl13 (ENSMUSG00000036782)
Vector Insertion
Chr X: 22892334 - 22938619
Public Clones DD0849 (sanger) (sanger) GST044 (baygenomics) RRJ678 (baygenomics) RST450 (baygenomics)
3SP105D04 (ggtc) P010D02 (ggtc) 5SD022H11 (ggtc) P128B08 (ggtc)
5SP105D04 (ggtc) P078H08 (ggtc) IST13635D6 (tigm) IST13053E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702438 (ChrX:22938620..22938710 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTTCAGACTGGGACTGAG ChrX:22938684..22938703 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702438 (ChrX:22938620..22938710 -)
Downstram Exon
ENSMUSE00000624545 (ChrX:22892256..22892333 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTTCAGACTGGGACTGAG ChrX:22938684..22938703 59.99 60 TTGCAGCAACCAATTCTCCT ChrX:22892247..22892266 60.78 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702439 ChrX:22942082..22942208 AGCTTGGAACAGGGACTTTG ChrX:22942112..22942131 59.33 50
upstream ENSMUSE00000702438 ChrX:22938620..22938710 GCCTTCAGACTGGGACTGAG ChrX:22938684..22938703 59.99 60

*** Putative Vector Insertion (Chr X: 22892334 - 22938619) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624545 ChrX:22892256..22892333 TTGCAGCAACCAATTCTCCT ChrX:22892247..22892266 60.78 45
downstream ENSMUSE00000702437 ChrX:22892256..22892327 GCAGCAACCAATTCTCCTCT ChrX:22892249..22892268 59.43 50
downstream ENSMUSE00000702446 ChrX:22862284..22862363 No primer for this exon
downstream ENSMUSE00000702444 ChrX:22861686..22861783 CAGGAGAGCTCGTTTTCCAT ChrX:22861731..22861750 59.43 50
downstream ENSMUSE00000702442 ChrX:22843811..22843866 No primer for this exon
downstream ENSMUSE00000370594 ChrX:22838561..22838699 CATTTCACTTCCAAGGCACA ChrX:22838623..22838642 59.69 45
downstream ENSMUSE00000702457 ChrX:22838561..22838699 CATTTCACTTCCAAGGCACA ChrX:22838623..22838642 59.69 45
downstream ENSMUSE00000318948 ChrX:22825238..22825370 ATGCCATCATGACTCTGTGC ChrX:22825249..22825268 59.67 50
downstream ENSMUSE00000318938 ChrX:22824487..22824683 TTCCGTAGACCCACTCTGCT ChrX:22824595..22824614 59.87 55
downstream ENSMUSE00000318923 ChrX:22812352..22813147 TGCGCAATTCTTTACTGACG ChrX:22812615..22812634 60.01 45
downstream ENSMUSE00000318908 ChrX:22805700..22805813 TGGCAACATAGGTCCATTCA ChrX:22805741..22805760 59.92 45
downstream ENSMUSE00000345795 ChrX:22796397..22797978 TGATGGTGTGGCTTCTTCAG ChrX:22797502..22797521 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT ChrX:22935549..22935569 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGACCGTGACTGGGAAAAC ChrX:22935553..22935573 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATAATCGCCTTGCAGCAC ChrX:22935643..22935663 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCATTACTAAAGCATTCTGTTGC ChrX:22935691..22935714 58.18 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036782