Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26413
Trapped Gene
Ccar1 (ENSMUSG00000020074)
Vector Insertion
Chr 10: 62229531 - 62233602
Public Clones not available
Private Clones OST119376 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000331288 (Chr10:62233603..62233764 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000331288 (Chr10:62233603..62233764 -)
Downstram Exon
ENSMUSE00000390440 (Chr10:62229305..62229530 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347270 Chr10:62254964..62255004 No primer for this exon
upstream ENSMUSE00000385154 Chr10:62253669..62253790 No primer for this exon
upstream ENSMUSE00000272514 Chr10:62248179..62248342 No primer for this exon
upstream ENSMUSE00000356298 Chr10:62246631..62246675 No primer for this exon
upstream ENSMUSE00000394538 Chr10:62245982..62246014 No primer for this exon
upstream ENSMUSE00000369684 Chr10:62243189..62243382 No primer for this exon
upstream ENSMUSE00000100371 Chr10:62239597..62239711 No primer for this exon
upstream ENSMUSE00000100363 Chr10:62239316..62239508 No primer for this exon
upstream ENSMUSE00000382158 Chr10:62234684..62234813 No primer for this exon
upstream ENSMUSE00000331288 Chr10:62233603..62233764 No primer for this exon

*** Putative Vector Insertion (Chr 10: 62229531 - 62233602) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390440 Chr10:62229305..62229530 No primer for this exon
downstream ENSMUSE00000100367 Chr10:62228690..62228803 No primer for this exon
downstream ENSMUSE00000100356 Chr10:62228015..62228181 No primer for this exon
downstream ENSMUSE00000100364 Chr10:62227072..62227282 No primer for this exon
downstream ENSMUSE00000100365 Chr10:62226188..62226271 No primer for this exon
downstream ENSMUSE00000272562 Chr10:62222842..62223027 No primer for this exon
downstream ENSMUSE00000272559 Chr10:62219231..62219422 No primer for this exon
downstream ENSMUSE00000718355 Chr10:62215922..62216161 No primer for this exon
downstream ENSMUSE00000720971 Chr10:62215922..62216161 No primer for this exon
downstream ENSMUSE00000395144 Chr10:62214491..62214602 No primer for this exon
downstream ENSMUSE00000666248 Chr10:62214491..62214602 No primer for this exon
downstream ENSMUSE00000365613 Chr10:62213685..62213764 No primer for this exon
downstream ENSMUSE00000666247 Chr10:62213685..62213764 No primer for this exon
downstream ENSMUSE00000373799 Chr10:62213295..62213441 No primer for this exon
downstream ENSMUSE00000666246 Chr10:62213295..62213441 No primer for this exon
downstream ENSMUSE00000272651 Chr10:62210092..62210212 No primer for this exon
downstream ENSMUSE00000666245 Chr10:62210092..62210212 No primer for this exon
downstream ENSMUSE00000272641 Chr10:62209649..62209834 No primer for this exon
downstream ENSMUSE00000666244 Chr10:62209649..62209834 No primer for this exon
downstream ENSMUSE00000337900 Chr10:62208011..62208216 No primer for this exon
downstream ENSMUSE00000666243 Chr10:62208011..62208216 No primer for this exon
downstream ENSMUSE00000380930 Chr10:62207210..62207570 No primer for this exon
downstream ENSMUSE00000666242 Chr10:62207210..62207570 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACGGTACACAGTGCAGTT Chr10:62233622..62233642 59.67 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACGGTACACAGTGCAGTT Chr10:62233622..62233642 59.67 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020074