Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26416
Trapped Gene
Ciao1 (ENSMUSG00000003662)
Vector Insertion
Chr 2: 127072895 - 127073217
Public Clones not available
Private Clones OST119312 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318837 (Chr2:127073218..127073479 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318837 (Chr2:127073218..127073479 -)
Downstram Exon
ENSMUSE00000168806 (Chr2:127072746..127072894 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000318837 Chr2:127073218..127073479 No primer for this exon

*** Putative Vector Insertion (Chr 2: 127072895 - 127073217) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000168806 Chr2:127072746..127072894 No primer for this exon
downstream ENSMUSE00000168807 Chr2:127072338..127072449 No primer for this exon
downstream ENSMUSE00000168808 Chr2:127072149..127072237 No primer for this exon
downstream ENSMUSE00000168811 Chr2:127071459..127071660 No primer for this exon
downstream ENSMUSE00000168810 Chr2:127070649..127070736 No primer for this exon
downstream ENSMUSE00000401160 Chr2:127068347..127068773 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCCGAGGAAAACACTACT Chr2:127073167..127073188 60.54 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCGAGGAAAACACTACTCC Chr2:127073165..127073185 58.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003662