Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26420
Trapped Gene
Usp4 (ENSMUSG00000032612)
Vector Insertion
Chr 9: 108262553 - 108264891
Public Clones not available
Private Clones OST119124 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000529787 (Chr9:108262426..108262552 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCCCACCAATGTGCTAAG Chr9:108262504..108262523 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000529787 (Chr9:108262426..108262552 +)
Downstram Exon
ENSMUSE00000244299 (Chr9:108264892..108265037 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCCCACCAATGTGCTAAG Chr9:108262504..108262523 60.38 55 AAAGCCGTGTTTCACGTTCT Chr9:108264957..108264976 59.78 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000244407 Chr9:108250199..108250349 ATGTGGAGACCCAGAAGACG Chr9:108250283..108250302 60.11 55
upstream ENSMUSE00000244380 Chr9:108253241..108253368 CTTATTGACAGCCGGTGGTT Chr9:108253245..108253264 59.99 50
upstream ENSMUSE00000244351 Chr9:108258742..108258872 AGCCGAAGCCTGGAATAAAT Chr9:108258803..108258822 60.06 45
upstream ENSMUSE00000529787 Chr9:108262426..108262552 GACCCCACCAATGTGCTAAG Chr9:108262504..108262523 60.38 55

*** Putative Vector Insertion (Chr 9: 108262553 - 108264891) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000244299 Chr9:108264892..108265037 AAAGCCGTGTTTCACGTTCT Chr9:108264957..108264976 59.78 45
downstream ENSMUSE00000221570 Chr9:108265168..108265229 TCTTCATTTTGGGGCTCAAT Chr9:108265199..108265218 59.51 40
downstream ENSMUSE00000244248 Chr9:108268161..108268301 ACTTGCGGATGGTTTTGAAG Chr9:108268218..108268237 60.11 45
downstream ENSMUSE00000244226 Chr9:108269092..108269209 GGCTCCTGGCAATTATACGA Chr9:108269133..108269152 60.06 50
downstream ENSMUSE00000244203 Chr9:108270150..108270323 CTCTGCAATCTCCCCTTTCA Chr9:108270257..108270276 60.33 50
downstream ENSMUSE00000221563 Chr9:108273232..108273390 TTCTTTACGCGGTTCAGGTC Chr9:108273347..108273366 60.25 50
downstream ENSMUSE00000221567 Chr9:108274893..108275117 ACATTCTGGGCAAACCAAAG Chr9:108275000..108275019 59.97 45
downstream ENSMUSE00000221576 Chr9:108275938..108276021 AATGGCACAGTCACACGGTA Chr9:108275960..108275979 60.03 50
downstream ENSMUSE00000221551 Chr9:108276555..108276649 AAATTTTGTGGAAGCGGTGA Chr9:108276600..108276619 60.48 40
downstream ENSMUSE00000221545 Chr9:108280767..108280958 ACAAGAAGGGGCTGTCCATA Chr9:108280898..108280917 59.55 50
downstream ENSMUSE00000221573 Chr9:108281596..108281684 CAGGCTCTAAGGGTGAGCTG Chr9:108281654..108281673 60.15 60
downstream ENSMUSE00000221552 Chr9:108283659..108283883 TTTGAGGAGTTTCCCGTCAG Chr9:108283879..108283898 60.22 50
downstream ENSMUSE00000221562 Chr9:108286416..108286486 AGTCAATGGCCAGTGTGGAT Chr9:108286442..108286461 60.4 50
downstream ENSMUSE00000221565 Chr9:108286728..108286846 TCTTCTTCTTCTGCGGCTGT Chr9:108286776..108286795 60.28 50
downstream ENSMUSE00000221556 Chr9:108287138..108287287 GGAGAAACGCTTGAGGTGAA Chr9:108287237..108287256 60.38 50
downstream ENSMUSE00000221547 Chr9:108290608..108290711 CCCATGGCTCCATAGTGATT Chr9:108290703..108290722 59.77 50
downstream ENSMUSE00000221569 Chr9:108293311..108293399 CCATTTCCCGTTCAGTCTGT Chr9:108293351..108293370 59.97 50
downstream ENSMUSE00000221572 Chr9:108294010..108294857 CCGACGCTGATAGAACAACA Chr9:108294048..108294067 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTCTGCATGTCTGGTGAA Chr9:108262569..108262589 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCTGCATGTCTGGTGAA Chr9:108262569..108262589 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032612