Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26423
Trapped Gene
Zdhhc20 (ENSMUSG00000021969)
Vector Insertion
Chr 14: 58497297 - 58508899
Public Clones IST13733F11 (tigm) IST14727A9 (tigm) IST12365E2 (tigm) IST14475G9 (tigm)
Private Clones OST118962 (lexicon) OST68501 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000558391 (Chr14:58508900..58509099 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTTTGTGGTCGTCTGGTC Chr14:58508932..58508951 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000558391 (Chr14:58508900..58509099 -)
Downstram Exon
ENSMUSE00000122547 (Chr14:58497270..58497296 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTTTGTGGTCGTCTGGTC Chr14:58508932..58508951 60.01 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000558391 Chr14:58508900..58509099 ACCTTTGTGGTCGTCTGGTC Chr14:58508932..58508951 60.01 55

*** Putative Vector Insertion (Chr 14: 58497297 - 58508899) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122547 Chr14:58497270..58497296 No primer for this exon
downstream ENSMUSE00000122526 Chr14:58492730..58492833 GGCTAGCAGGAGACGTGAAT Chr14:58492719..58492738 59.46 55
downstream ENSMUSE00000122540 Chr14:58484358..58484478 AGGTCTCTTGCCGCTCTTCT Chr14:58484365..58484384 60.67 55
downstream ENSMUSE00000122541 Chr14:58477377..58477446 GGCTCGGTCAGGTTTAATCA Chr14:58477378..58477397 60.07 50
downstream ENSMUSE00000558401 Chr14:58476465..58476497 No primer for this exon
downstream ENSMUSE00000307301 Chr14:58475447..58475567 AAAACTGTTGCAGCCACAAA Chr14:58475450..58475469 59.37 40
downstream ENSMUSE00000558399 Chr14:58468982..58469017 No primer for this exon
downstream ENSMUSE00000307294 Chr14:58465758..58465899 CGAAGAACATTGCAGACACAA Chr14:58465799..58465819 59.9 42.86
downstream ENSMUSE00000307283 Chr14:58462025..58462151 TGCATCCAAGAGAGAAACCAT Chr14:58462067..58462087 59.69 42.86
downstream ENSMUSE00000122534 Chr14:58459666..58459755 AGCTGGAAAACTGCAACCAT Chr14:58459706..58459725 59.74 45
downstream ENSMUSE00000122556 Chr14:58457927..58458042 TCACTGTCCAATAAGCGGTTT Chr14:58457952..58457972 59.62 42.86
downstream ENSMUSE00000354959 Chr14:58456428..58456504 No primer for this exon
downstream ENSMUSE00000615304 Chr14:58451539..58455483 TTTTGAGCTGTGAGGCAATG Chr14:58455259..58455278 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTGCGTGAGTGAGTACG Chr14:58502889..58502909 60.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTGCGTGAGTGAGTACG Chr14:58502889..58502909 60.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCATAGCCTCCGTTTTCTCA Chr14:58506106..58506126 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCATAGCCTCCGTTTTCTCA Chr14:58506106..58506126 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021969