Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26437
Trapped Gene
1700001P01Rik (ENSMUSG00000018543)
Vector Insertion
Chr 11: 97633052 - 97634029
Public Clones not available
Private Clones OST118192 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000577583 (Chr11:97634030..97634129 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000577583 (Chr11:97634030..97634129 -)
Downstram Exon
ENSMUSE00000673696 (Chr11:97632795..97633051 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382080 Chr11:97636966..97637232 No primer for this exon
upstream ENSMUSE00000705938 Chr11:97636966..97637191 No primer for this exon
upstream ENSMUSE00000577583 Chr11:97634030..97634129 No primer for this exon

*** Putative Vector Insertion (Chr 11: 97633052 - 97634029) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577581 Chr11:97632897..97633051 No primer for this exon
downstream ENSMUSE00000521023 Chr11:97632842..97632895 No primer for this exon
downstream ENSMUSE00000673696 Chr11:97632795..97633051 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr11:97633961..97633981 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAAAGCGTGACTGGGAAA Chr11:97633965..97633985 60.23 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018543