Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26444
Trapped Gene
Dtx1 (ENSMUSG00000029603)
Vector Insertion
Chr 5: 121133132 - 121133303
Public Clones not available
Private Clones OST117799 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000190622 (Chr5:121133304..121133465 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAAGCAAAAGCGACGTGAAG Chr5:121133362..121133381 59.25 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000190622 (Chr5:121133304..121133465 -)
Downstram Exon
ENSMUSE00000190625 (Chr5:121133070..121133131 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAAGCAAAAGCGACGTGAAG Chr5:121133362..121133381 59.25 45 TGTACCTCCGAACCACATCC Chr5:121133077..121133096 60.78 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431793 Chr5:121161494..121161678 AGGACTACTGCGTCCTCCTG Chr5:121161623..121161642 59.47 60
upstream ENSMUSE00000468189 Chr5:121160064..121160984 GTGCCCTACATCATCGACCT Chr5:121160096..121160115 59.96 55
upstream ENSMUSE00000471013 Chr5:121144419..121145121 CTTCAACAGCATGTCCCAGA Chr5:121144906..121144925 59.83 50
upstream ENSMUSE00000190629 Chr5:121133696..121133757 TCCCCGTGAAGAACTTGAAT Chr5:121133727..121133746 59.53 45
upstream ENSMUSE00000190622 Chr5:121133304..121133465 TAAGCAAAAGCGACGTGAAG Chr5:121133362..121133381 59.25 45

*** Putative Vector Insertion (Chr 5: 121133132 - 121133303) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000190625 Chr5:121133070..121133131 TGTACCTCCGAACCACATCC Chr5:121133077..121133096 60.78 55
downstream ENSMUSE00000190620 Chr5:121132589..121132747 CCCTCATAGCCAGATGCTGT Chr5:121132676..121132695 60.24 55
downstream ENSMUSE00000190627 Chr5:121132313..121132474 TGTCTTCTCCCCGTAGATGG Chr5:121132402..121132421 60.06 55
downstream ENSMUSE00000402852 Chr5:121132130..121132219 GCCCTTCTCATTGTTGGGTA Chr5:121132114..121132133 59.93 50
downstream ENSMUSE00000477256 Chr5:121130273..121131481 AGCCAGCACGTTGTCTAGGT Chr5:121131280..121131299 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCAAGACCAAGAAGAAACAC Chr5:121133312..121133333 59.91 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTAGGACCCAGCGTGACT Chr5:121133245..121133265 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029603