Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26446
Trapped Gene
Nfic (ENSMUSG00000055053)
Vector Insertion
Chr 10: 80871155 - 80872355
Public Clones not available
Private Clones OST117564 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000609201 (Chr10:80872356..80872427 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGACCAGGAGGACAGCAAG Chr10:80872369..80872388 61 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000609201 (Chr10:80872356..80872427 -)
Downstram Exon
ENSMUSE00000609200 (Chr10:80871080..80871154 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGACCAGGAGGACAGCAAG Chr10:80872369..80872388 61 60 TGAACACACCTGACGTGACA Chr10:80871088..80871107 59.74 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708050 Chr10:80893531..80893750 No primer for this exon
upstream ENSMUSE00000665813 Chr10:80889821..80889902 GATGTATTCCTCCCCGCTCT Chr10:80889832..80889851 60.43 55
upstream ENSMUSE00000609202 Chr10:80883012..80883543 TGGACCTGTACCTGGCCTAC Chr10:80883028..80883047 59.99 60
upstream ENSMUSE00000609201 Chr10:80872356..80872427 CAGACCAGGAGGACAGCAAG Chr10:80872369..80872388 61 60

*** Putative Vector Insertion (Chr 10: 80871155 - 80872355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609200 Chr10:80871080..80871154 TGAACACACCTGACGTGACA Chr10:80871088..80871107 59.74 50
downstream ENSMUSE00000609206 Chr10:80870946..80870974 No primer for this exon
downstream ENSMUSE00000609199 Chr10:80870851..80870974 TTCAGGTCATATGCCAGGTG Chr10:80870880..80870899 59.52 50
downstream ENSMUSE00000609198 Chr10:80870300..80870424 TGCTACTCGTGGGTGAGTTG Chr10:80870308..80870327 59.9 55
downstream ENSMUSE00000609204 Chr10:80868835..80868959 TGTGGTGTTGTGTGAAGCTG Chr10:80868836..80868855 59.32 50
downstream ENSMUSE00000102220 Chr10:80868834..80868959 TGTGGTGTTGTGTGAAGCTG Chr10:80868836..80868855 59.32 50
downstream ENSMUSE00000491816 Chr10:80867569..80867753 GGGAAGTAGGTGGAGGCTGT Chr10:80867647..80867666 60.51 60
downstream ENSMUSE00000495120 Chr10:80867569..80867715 GGGAAGTAGGTGGAGGCTGT Chr10:80867647..80867666 60.51 60
downstream ENSMUSE00000609197 Chr10:80866097..80866173 AAGAGGATCCCTCCGTCCTA Chr10:80866084..80866103 60.03 55
downstream ENSMUSE00000721179 Chr10:80863698..80863816 GGGGCTTCTCACTCCATCTA Chr10:80863676..80863695 59.24 55
downstream ENSMUSE00000383195 Chr10:80863647..80863816 GGGGCTTCTCACTCCATCTA Chr10:80863676..80863695 59.24 55
downstream ENSMUSE00000705337 Chr10:80863647..80863816 GGGGCTTCTCACTCCATCTA Chr10:80863676..80863695 59.24 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGAGCTGAGGCAGGAGGA Chr10:80872325..80872345 59.84 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCTGAGGCAGGAGGATT Chr10:80872323..80872343 60.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055053