Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26447
Trapped Gene
1810020D17Rik (ENSMUSG00000035642)
Vector Insertion
Chr 7: 104713811 - 104724097
Public Clones not available
Private Clones OST117561 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717798 (Chr7:104724098..104724201 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGGTTCCCTGAACTCCTC Chr7:104724137..104724156 59.23 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717798 (Chr7:104724098..104724201 -)
Downstram Exon
ENSMUSE00000483109 (Chr7:104713661..104713810 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGGTTCCCTGAACTCCTC Chr7:104724137..104724156 59.23 55 CCTGGCCATACTTTGCAATC Chr7:104713679..104713698 60.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590611 Chr7:104727876..104727962 GATCCGACTGGAGGAACAAC Chr7:104727894..104727913 59.51 55
upstream ENSMUSE00000715517 Chr7:104724098..104724201 TGAGGTTCCCTGAACTCCTC Chr7:104724137..104724156 59.23 55
upstream ENSMUSE00000717798 Chr7:104724098..104724201 TGAGGTTCCCTGAACTCCTC Chr7:104724137..104724156 59.23 55

*** Putative Vector Insertion (Chr 7: 104713811 - 104724097) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000483109 Chr7:104713661..104713810 CCTGGCCATACTTTGCAATC Chr7:104713679..104713698 60.47 50
downstream ENSMUSE00000443894 Chr7:104706641..104706736 TTTACATCTGCTGGCTGCAC Chr7:104706683..104706702 60.02 50
downstream ENSMUSE00000270136 Chr7:104698853..104699251 CAACCTGGAGTGCAAAACCT Chr7:104698938..104698957 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:104721026..104721046 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCAGCAACTGCGTGACTGG Chr7:104721037..104721057 62.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035642