Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26454
Trapped Gene
1810009A15Rik (ENSMUSG00000071653)
Vector Insertion
Chr 19: 8963739 - 8964492
Public Clones (sanger) (ggtc) D168A12 (ggtc) (ggtc) (ggtc) 5SE306G02 (ggtc)
D168A12 (ggtc) (ggtc) IST14190G10 (tigm) IST14954D11 (tigm) IST10430G9 (tigm)
Private Clones OST116848 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621632 (Chr19:8963614..8963738 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCACCACCTCAAGAAGC Chr19:8963715..8963734 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621632 (Chr19:8963614..8963738 +)
Downstram Exon
ENSMUSE00000621631 (Chr19:8964493..8964590 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCACCACCTCAAGAAGC Chr19:8963715..8963734 60 55 CAAGAGTTTCCTGCGCTTCT Chr19:8964550..8964569 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621633 Chr19:8963410..8963454 CTCCGGGAGGAAAGATCAAT Chr19:8963423..8963442 60.4 50
upstream ENSMUSE00000621632 Chr19:8963614..8963738 GAAGCACCACCTCAAGAAGC Chr19:8963715..8963734 60 55

*** Putative Vector Insertion (Chr 19: 8963739 - 8964492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621631 Chr19:8964493..8964590 CAAGAGTTTCCTGCGCTTCT Chr19:8964550..8964569 59.76 50
downstream ENSMUSE00000621630 Chr19:8964901..8965230 CAGGGTCCGCTGTAGAAGAG Chr19:8965130..8965149 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTACCATAATCGCCTTGC Chr19:8963782..8963802 60.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000071653