Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26460
Trapped Gene
Xpnpep2 (ENSMUSG00000037005)
Vector Insertion
Chr X: 45462095 - 45462372
Public Clones not available
Private Clones OST116638 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701396 (ChrX:45461902..45462371 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTAAGCCACAAGAAACCA ChrX:45462087..45462106 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701396 (ChrX:45461902..45462371 +)
Downstram Exon
ENSMUSE00000555307 (ChrX:45462096..45462371 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTAAGCCACAAGAAACCA ChrX:45462087..45462106 60.1 50 TGTTTGGTGGCCTCTTCTTC ChrX:45462270..45462289 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701396 ChrX:45461902..45462371 CCCTAAGCCACAAGAAACCA ChrX:45462087..45462106 60.1 50

*** Putative Vector Insertion (Chr X: 45462095 - 45462372) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000555307 ChrX:45462096..45462371 TGTTTGGTGGCCTCTTCTTC ChrX:45462270..45462289 60.23 50
downstream ENSMUSE00000321370 ChrX:45464902..45464975 CAGGGCTGGTTGAACAGTTT ChrX:45464976..45464995 60.15 50
downstream ENSMUSE00000321363 ChrX:45466854..45466964 CAAGCCGCATTGTTGTATTG ChrX:45466896..45466915 60.13 45
downstream ENSMUSE00000321353 ChrX:45469105..45469168 TGAAATCCACTCTCGCCTCT ChrX:45469152..45469171 59.95 50
downstream ENSMUSE00000321345 ChrX:45470129..45470233 TTCGGCCTGAGTCCAGTAAC ChrX:45470199..45470218 60.26 55
downstream ENSMUSE00000321340 ChrX:45470455..45470541 AGCTAAGATCCAGGCGACAA ChrX:45470492..45470511 59.98 50
downstream ENSMUSE00000321334 ChrX:45471512..45471658 CCGATAACAGGTGTCTGCTG ChrX:45471571..45471590 59.31 55
downstream ENSMUSE00000321328 ChrX:45474978..45475079 ATAGCTTCGGACAGCGGATA ChrX:45475021..45475040 59.83 50
downstream ENSMUSE00000701369 ChrX:45474978..45475280 ATGTTGCAAGGTCCAGGAAG ChrX:45475146..45475165 60.11 50
downstream ENSMUSE00000321323 ChrX:45475706..45475787 TCGTGAGCAGTGCATAGGAG ChrX:45475777..45475796 60.16 55
downstream ENSMUSE00000321317 ChrX:45476065..45476260 GGTCTCAAGGCTAAAGCGACT ChrX:45476103..45476123 60.03 52.38
downstream ENSMUSE00000321307 ChrX:45477016..45477105 TGCTCCTTGCTGTTCTTCAC ChrX:45477086..45477105 59.17 50
downstream ENSMUSE00000321297 ChrX:45477793..45477902 TCTGCCCCAGAAAACTCATC ChrX:45477884..45477903 60.19 50
downstream ENSMUSE00000321287 ChrX:45478522..45478599 GGCCACTAGCAGAGATGGTT ChrX:45478577..45478596 59.31 55
downstream ENSMUSE00000321278 ChrX:45480046..45480117 GCTTACGGTGCAGCTCTTTT ChrX:45480074..45480093 59.66 50
downstream ENSMUSE00000321273 ChrX:45481902..45481962 AGGAGTGCCCCAATGTACTG ChrX:45481950..45481969 59.99 55
downstream ENSMUSE00000321263 ChrX:45483224..45483293 GATCGATGTTTCCCATTAGCA ChrX:45483262..45483282 59.92 42.86
downstream ENSMUSE00000321258 ChrX:45483856..45483960 ACAGAGGAAGTTGCCAATGC ChrX:45483953..45483972 60.26 50
downstream ENSMUSE00000321252 ChrX:45484325..45484384 GGAAGTGAACATGCCCTTGG ChrX:45484383..45484402 62.76 55
downstream ENSMUSE00000555313 ChrX:45485075..45485151 CTACCACAAGGGCGACATCT ChrX:45485140..45485159 60.13 55
downstream ENSMUSE00000701367 ChrX:45486153..45487202 TCTTCATCGCTTCTGGGTCT ChrX:45486269..45486288 59.95 50
downstream ENSMUSE00000321240 ChrX:45488262..45488351 GCCTGACATCGATGAGGTTT ChrX:45488337..45488356 60.08 50
downstream ENSMUSE00000701368 ChrX:45488912..45489845 GGGACATGTATGGCATAGGG ChrX:45489200..45489219 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000037005