Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26463
Trapped Gene
Zfp202 (ENSMUSG00000025602)
Vector Insertion
Chr 9: 40000023 - 40014783
Public Clones (sanger) (sanger) (sanger) (sanger) IST10507B4 (tigm) IST11704B10 (tigm)
IST14198H9 (tigm) IST13748C8 (tigm) IST14198H9 (tigm)
Private Clones OST116550 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000152021 (Chr9:39999911..40000022 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000152021 (Chr9:39999911..40000022 +)
Downstram Exon
ENSMUSE00000152024 (Chr9:40014784..40015279 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TATCGAAAGCGTCGGAAGTT Chr9:40015041..40015060 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000152021 Chr9:39999911..40000022 No primer for this exon

*** Putative Vector Insertion (Chr 9: 40000023 - 40014783) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000152024 Chr9:40014784..40015279 TATCGAAAGCGTCGGAAGTT Chr9:40015041..40015060 59.85 45
downstream ENSMUSE00000152027 Chr9:40015890..40016100 GCCCTAGGTGTAGGGTCTCC Chr9:40015950..40015969 59.96 65
downstream ENSMUSE00000152022 Chr9:40016463..40016551 AGCAACCATCTCTGGGTGTC Chr9:40016533..40016552 60.12 55
downstream ENSMUSE00000152026 Chr9:40017352..40017481 CACAGAGCCACATCCTTGAA Chr9:40017386..40017405 59.83 50
downstream ENSMUSE00000152028 Chr9:40018026..40018145 TTCTGGTTCTGCAGGCTCTT Chr9:40018126..40018145 60.13 50
downstream ENSMUSE00000379619 Chr9:40018481..40020771 CACAGATGGTGCTCCTCAGA Chr9:40019207..40019226 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGATGAAGACATGATGGA Chr9:40009031..40009052 60.22 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACACGTGACTGGGAAAACC Chr9:40009069..40009090 61.36 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025602