Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26465
Trapped Gene
Trp53rk (ENSMUSG00000042854)
Vector Insertion
Chr 2: 166619889 - 166620881
Public Clones not available
Private Clones OST116528 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434503 (Chr2:166618691..166619888 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAACGAGTTTCCTGAGAG Chr2:166619038..166619057 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434503 (Chr2:166618691..166619888 +)
Downstram Exon
ENSMUSE00000411015 (Chr2:166620882..166621652 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAACGAGTTTCCTGAGAG Chr2:166619038..166619057 59.99 55 CAGCACGATCACAGACCACT Chr2:166621460..166621479 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434512 Chr2:166618031..166618207 AACACATCCTGCCACACAAA Chr2:166618056..166618075 60.01 45
upstream ENSMUSE00000434503 Chr2:166618691..166619888 GCCAACGAGTTTCCTGAGAG Chr2:166619038..166619057 59.99 55
upstream ENSMUSE00000353112 Chr2:166619297..166619568 ACCGCTTCCCGAAGAGTTAC Chr2:166619467..166619486 60.63 55

*** Putative Vector Insertion (Chr 2: 166619889 - 166620881) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411015 Chr2:166620882..166621652 CAGCACGATCACAGACCACT Chr2:166621460..166621479 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCATGACATCCAATAAATG Chr2:166619857..166619878 59.25 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCATGACATCCAATAAATG Chr2:166619857..166619878 59.25 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042854