Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26470
Trapped Gene
Lims1 (ENSMUSG00000019920)
Vector Insertion
Chr 10: 57870885 - 57872307
Public Clones not available
Private Clones OST116058 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099141 (Chr10:57870818..57870884 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099141 (Chr10:57870818..57870884 +)
Downstram Exon
ENSMUSE00000099140 (Chr10:57872308..57872428 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643403 Chr10:57786295..57786435 No primer for this exon
upstream ENSMUSE00000099137 Chr10:57857121..57857348 No primer for this exon
upstream ENSMUSE00000666363 Chr10:57857136..57857348 No primer for this exon
upstream ENSMUSE00000099136 Chr10:57861769..57861928 No primer for this exon
upstream ENSMUSE00000099141 Chr10:57870818..57870884 No primer for this exon

*** Putative Vector Insertion (Chr 10: 57870885 - 57872307) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099140 Chr10:57872308..57872428 No primer for this exon
downstream ENSMUSE00000099129 Chr10:57872801..57872950 No primer for this exon
downstream ENSMUSE00000576223 Chr10:57875151..57875301 No primer for this exon
downstream ENSMUSE00000099139 Chr10:57876721..57876813 No primer for this exon
downstream ENSMUSE00000099134 Chr10:57879382..57879430 No primer for this exon
downstream ENSMUSE00000576219 Chr10:57881147..57881222 No primer for this exon
downstream ENSMUSE00000099131 Chr10:57881395..57881534 No primer for this exon
downstream ENSMUSE00000394070 Chr10:57884202..57887437 No primer for this exon
downstream ENSMUSE00000407098 Chr10:57884202..57884531 No primer for this exon
downstream ENSMUSE00000666362 Chr10:57884202..57884326 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr10:57870933..57870953 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCACCAATGTGGTAAGTTT Chr10:57870873..57870894 60.28 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019920