Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26482
Trapped Gene
Msra (ENSMUSG00000054733)
Vector Insertion
Chr 14: 64742191 - 64829264
Public Clones IST12878A10 (tigm) IST13952A11 (tigm) IST12452D2 (tigm) IST13952A11 (tigm)
IST12878A10 (tigm)
Private Clones OST115369 (lexicon) OST31587 (lexicon) OST31281 (lexicon) OST31254 (lexicon)
OST28981 (lexicon) OST28963 (lexicon) OST28631 (lexicon) OST26972 (lexicon)
OST26945 (lexicon) OST23762 (lexicon) OST23391 (lexicon) OST19048 (lexicon)
OST18074 (lexicon) OST17515 (lexicon) OST10660 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000423996 (Chr14:64829265..64829371 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAGTACCGGTCAGCAGTC Chr14:64829325..64829344 59.34 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000423996 (Chr14:64829265..64829371 -)
Downstram Exon
ENSMUSE00000423991 (Chr14:64741466..64742190 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAGTACCGGTCAGCAGTC Chr14:64829325..64829344 59.34 60 ACACTTGTCCCTCTCGGATG Chr14:64742111..64742130 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000557621 Chr14:65074719..65074740 No primer for this exon
upstream ENSMUSE00000557620 Chr14:65073596..65073730 CCAAGGCTGGAATGACTTCT Chr14:65073641..65073660 59.28 50
upstream ENSMUSE00000557619 Chr14:65072299..65072400 CACCGTTTGAAGAAGTGCTG Chr14:65072375..65072394 59.49 50
upstream ENSMUSE00000557617 Chr14:65071234..65071312 AGATTAGCAAGGTCGGATGG Chr14:65071270..65071289 59.15 50
upstream ENSMUSE00000557616 Chr14:65069801..65069875 GCTCAGCTTCGAGATCTTCCT Chr14:65069818..65069838 60.25 52.38
upstream ENSMUSE00000424013 Chr14:65059547..65059863 GCGACTCAGCTTCGAAAGTC Chr14:65059599..65059618 60.28 55
upstream ENSMUSE00000497089 Chr14:64932524..64932592 ATGTCAGTGGCAACAGAACG Chr14:64932564..64932583 59.75 50
upstream ENSMUSE00000424024 Chr14:64903901..64904020 ACACACGCAATCCCACCTAC Chr14:64903917..64903936 60.84 55
upstream ENSMUSE00000424002 Chr14:64852666..64852770 GAAGTCGTCCGGGTTGTGTA Chr14:64852734..64852753 60.95 55
upstream ENSMUSE00000423996 Chr14:64829265..64829371 CACAGTACCGGTCAGCAGTC Chr14:64829325..64829344 59.34 60

*** Putative Vector Insertion (Chr 14: 64742191 - 64829264) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000423991 Chr14:64741466..64742190 ACACTTGTCCCTCTCGGATG Chr14:64742111..64742130 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTTGGGCCTTTTTAATCG Chr14:64808207..64808227 60.89 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCTACCTTCCCTCGGATA Chr14:64808219..64808239 59.66 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATAATCGCCTTGCAGCAC Chr14:64808304..64808324 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGGGGGTCAGAGTAGGACA Chr14:64808371..64808391 60.1 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054733