Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26507
Trapped Gene
Tmem108 (ENSMUSG00000042757)
Vector Insertion
Chr 9: 103391674 - 103401131
Public Clones not available
Private Clones OST113906 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503630 (Chr9:103401132..103402538 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGATGCCACTGTCTCAGC Chr9:103401473..103401492 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503630 (Chr9:103401132..103402538 -)
Downstram Exon
ENSMUSE00000318056 (Chr9:103391519..103391673 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGATGCCACTGTCTCAGC Chr9:103401473..103401492 59.99 50 CCATTGTGATGGCATTGTTC Chr9:103391559..103391578 59.78 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634725 Chr9:103664085..103664132 No primer for this exon
upstream ENSMUSE00000634724 Chr9:103655185..103655297 ATGGGTTGCGAGGATGTAAG Chr9:103655219..103655238 59.96 50
upstream ENSMUSE00000634723 Chr9:103512041..103512126 GGCCCTCTATTGCCAACTATT Chr9:103512043..103512063 59.48 47.62
upstream ENSMUSE00000503630 Chr9:103401132..103402538 TTTGATGCCACTGTCTCAGC Chr9:103401473..103401492 59.99 50

*** Putative Vector Insertion (Chr 9: 103391674 - 103401131) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000318056 Chr9:103391519..103391673 CCATTGTGATGGCATTGTTC Chr9:103391559..103391578 59.78 45
downstream ENSMUSE00000530513 Chr9:103386108..103387113 GGAACCTCTACATGCCCAGA Chr9:103386694..103386713 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAAATCTGAAGGGGCAGCA Chr9:103398112..103398132 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCATCATCTTTCCCATCC Chr9:103401080..103401100 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042757