Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26525
Trapped Gene
Lrrc25 (ENSMUSG00000049988)
Vector Insertion
Chr 8: 73142264 - 73144462
Public Clones not available
Private Clones OST113035 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000348120 (Chr8:73141461..73142263 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGACAAGCTGGAAAAGC Chr8:73141721..73141740 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000348120 (Chr8:73141461..73142263 +)
Downstram Exon
ENSMUSE00000356784 (Chr8:73144463..73144749 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGACAAGCTGGAAAAGC Chr8:73141721..73141740 60.13 50 GTGTCCTCTACCCCCTGTGA Chr8:73144650..73144669 59.96 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454065 Chr8:73140743..73140925 ACCCTGAGGCTTACGAGACA Chr8:73140890..73140909 59.87 55
upstream ENSMUSE00000348120 Chr8:73141461..73142263 CTTCGACAAGCTGGAAAAGC Chr8:73141721..73141740 60.13 50

*** Putative Vector Insertion (Chr 8: 73142264 - 73144462) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000356784 Chr8:73144463..73144749 GTGTCCTCTACCCCCTGTGA Chr8:73144650..73144669 59.96 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAGATCCCTGCCCACAGT Chr8:73142274..73142294 59.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTTTAGCAGCGTGACTG Chr8:73142303..73142323 59.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049988