Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26532
Trapped Gene
Casc5 (ENSMUSG00000027326)
Vector Insertion
Chr 2: 118884131 - 118885279
Public Clones not available
Private Clones OST112403 (lexicon) OST96762 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000168443 (Chr2:118884091..118884130 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000168443 (Chr2:118884091..118884130 +)
Downstram Exon
ENSMUSE00000168435 (Chr2:118885280..118885339 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCTGAAGAGGACTCCTTGG Chr2:118885314..118885333 59.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685609 Chr2:118872855..118872959 GCATCACTAGGGCGGTTAGA Chr2:118872866..118872885 60.24 55
upstream ENSMUSE00000345237 Chr2:118872886..118873296 GAATGCTCCTTTCCGTTCTG Chr2:118872978..118872997 59.81 50
upstream ENSMUSE00000384970 Chr2:118883017..118883067 TTTTCAAAAATGGATGGGGTA Chr2:118883024..118883044 59.15 33.33
upstream ENSMUSE00000708026 Chr2:118883017..118883067 TTTTCAAAAATGGATGGGGTA Chr2:118883024..118883044 59.15 33.33
upstream ENSMUSE00000168443 Chr2:118884091..118884130 No primer for this exon

*** Putative Vector Insertion (Chr 2: 118884131 - 118885279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000168435 Chr2:118885280..118885339 TCCTGAAGAGGACTCCTTGG Chr2:118885314..118885333 59.38 55
downstream ENSMUSE00000168441 Chr2:118888096..118888157 GACTCGACGAGAGCTTTTCC Chr2:118888140..118888159 59.17 55
downstream ENSMUSE00000168434 Chr2:118889781..118889833 No primer for this exon
downstream ENSMUSE00000168433 Chr2:118891685..118891737 CTGAATTGGAGCACAAAGCA Chr2:118891719..118891738 59.99 45
downstream ENSMUSE00000168437 Chr2:118893859..118898655 AGCGCTATGGCACTTTCAGT Chr2:118897217..118897236 60.04 50
downstream ENSMUSE00000642270 Chr2:118893859..118898355 AGCGCTATGGCACTTTCAGT Chr2:118897217..118897236 60.04 50
downstream ENSMUSE00000642269 Chr2:118901968..118902106 TGCTGCAACTAGACGGTGTC Chr2:118902061..118902080 60.06 55
downstream ENSMUSE00000642268 Chr2:118902672..118902739 No primer for this exon
downstream ENSMUSE00000642267 Chr2:118903634..118903732 GGAGAGTGCTCTGCCTAGGTT Chr2:118903726..118903746 60.03 57.14
downstream ENSMUSE00000642266 Chr2:118907246..118907361 TCTTTTGTCGAAGAAGCTCACA Chr2:118907355..118907376 60.17 40.91
downstream ENSMUSE00000642265 Chr2:118912296..118912386 TCACTTTTTCCCACAAGTTCCT Chr2:118912367..118912388 60.01 40.91
downstream ENSMUSE00000642264 Chr2:118913212..118913328 GAGCCACTTTTCCTTGGTGA Chr2:118913302..118913321 60.23 50
downstream ENSMUSE00000168450 Chr2:118914535..118914622 TTTCCACTTCAGCGAGACAG Chr2:118914622..118914641 59.16 50
downstream ENSMUSE00000168463 Chr2:118919742..118919819 CATTCTTCCATGGCATCATTT Chr2:118919792..118919812 59.78 38.1
downstream ENSMUSE00000168458 Chr2:118920002..118920041 No primer for this exon
downstream ENSMUSE00000168456 Chr2:118920864..118920965 AGGGTCTGCGTTTTCTGTGT Chr2:118920905..118920924 59.77 50
downstream ENSMUSE00000168454 Chr2:118923154..118923254 GGCTCTCCAAAGGTGATGAT Chr2:118923252..118923271 59.09 50
downstream ENSMUSE00000168448 Chr2:118925498..118925566 No primer for this exon
downstream ENSMUSE00000168452 Chr2:118926449..118926558 GCTGTGCTGTGCATTTCTTC Chr2:118926547..118926566 59.6 50
downstream ENSMUSE00000168447 Chr2:118927718..118927836 GCTATAATTTGGCCCCCATC Chr2:118927810..118927829 60.49 50
downstream ENSMUSE00000168462 Chr2:118928235..118928357 CAAATGCTGCACAACTGGAG Chr2:118928272..118928291 60.45 50
downstream ENSMUSE00000168460 Chr2:118929714..118929857 CTGTGGGTCTTACGGGAAAA Chr2:118929839..118929858 59.96 50
downstream ENSMUSE00000685604 Chr2:118929714..118931237 CTGTGGGTCTTACGGGAAAA Chr2:118929839..118929858 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr2:118884181..118884201 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAATATCGTGACTGGGAAAA Chr2:118884175..118884196 58.08 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027326