Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26538
Trapped Gene
Ndufa13 (ENSMUSG00000036199)
Vector Insertion
Chr 8: 72418475 - 72419140
Public Clones not available
Private Clones OST112042 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000235929 (Chr8:72419141..72419219 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGCCTTGATCTTTGGCTAC Chr8:72419173..72419192 60.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000235929 (Chr8:72419141..72419219 -)
Downstram Exon
ENSMUSE00000235919 (Chr8:72418403..72418474 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGCCTTGATCTTTGGCTAC Chr8:72419173..72419192 60.96 55 CCTCCAAGTCCTCAATCAGC Chr8:72418427..72418446 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683012 Chr8:72425441..72425547 CATCGACTACAAGCGGAACC Chr8:72425462..72425481 60.66 55
upstream ENSMUSE00000235929 Chr8:72419141..72419219 GGGCCTTGATCTTTGGCTAC Chr8:72419173..72419192 60.96 55

*** Putative Vector Insertion (Chr 8: 72418475 - 72419140) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235919 Chr8:72418403..72418474 CCTCCAAGTCCTCAATCAGC Chr8:72418427..72418446 59.8 55
downstream ENSMUSE00000401758 Chr8:72418087..72418309 CTTCCTCCTCCAGGTTTTCC Chr8:72418250..72418269 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGAATGATGAGGTGGAA Chr8:72419151..72419171 59.01 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGGGTTCTGTGAGGATGA Chr8:72419097..72419117 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036199