Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26575
Trapped Gene
Cryl1 (ENSMUSG00000021947)
Vector Insertion
Chr 14: 58001703 - 58017244
Public Clones not available
Private Clones OST109796 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000558530 (Chr14:58017245..58017360 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000558530 (Chr14:58017245..58017360 -)
Downstram Exon
ENSMUSE00000308648 (Chr14:58001595..58001702 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTTCCAGGGCGTCTGTTATC Chr14:58001580..58001599 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000558530 Chr14:58017245..58017360 No primer for this exon

*** Putative Vector Insertion (Chr 14: 58001703 - 58017244) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000308648 Chr14:58001595..58001702 TTTCCAGGGCGTCTGTTATC Chr14:58001580..58001599 60.07 50
downstream ENSMUSE00000122361 Chr14:57981759..57981885 TGCTCCAGGGATTTCATCTC Chr14:57981840..57981859 60.16 50
downstream ENSMUSE00000558523 Chr14:57960889..57961035 CGTCGGTCACAGACAACACT Chr14:57960940..57960959 59.78 55
downstream ENSMUSE00000426676 Chr14:57931805..57931966 ATAACCCGGTCATCCACAAT Chr14:57931868..57931887 58.98 45
downstream ENSMUSE00000426671 Chr14:57922430..57922624 GAAGCCGTCAATCTCCTTCA Chr14:57922462..57922481 60.34 50
downstream ENSMUSE00000426667 Chr14:57905202..57905307 TAGTCTCCAAGGGTCCGATG Chr14:57905198..57905217 60.06 55
downstream ENSMUSE00000426663 Chr14:57894754..57894860 AACAGGCCCGAAAGTACTGA Chr14:57894771..57894790 59.73 50
downstream ENSMUSE00000615387 Chr14:57893872..57894399 GAAATTCACTTGGGCTGCAT Chr14:57894259..57894278 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCCAGGGAGAGAACACAC Chr14:58002267..58002287 59.53 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCCAGGGAGAGAACACAC Chr14:58002267..58002287 59.53 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021947