Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26582
Trapped Gene
D6Wsu176e (ENSMUSG00000029672)
Vector Insertion
Chr 6: 22278679 - 22279578
Public Clones not available
Private Clones OST109333 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326989 (Chr6:22279579..22279608 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326989 (Chr6:22279579..22279608 -)
Downstram Exon
ENSMUSE00000326982 (Chr6:22278555..22278678 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACATTGGCTGCTCCACTAGC Chr6:22278566..22278585 60.43 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702663 Chr6:22305995..22306130 No primer for this exon
upstream ENSMUSE00000702662 Chr6:22293266..22293319 GGCAAAAATGAGGGTAGCAG Chr6:22293266..22293285 59.71 50
upstream ENSMUSE00000326995 Chr6:22289273..22289377 GGCCGTGGCAGTATTCTTAC Chr6:22289339..22289358 59.6 55
upstream ENSMUSE00000326989 Chr6:22279579..22279608 No primer for this exon

*** Putative Vector Insertion (Chr 6: 22278679 - 22279578) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000326982 Chr6:22278555..22278678 ACATTGGCTGCTCCACTAGC Chr6:22278566..22278585 60.43 55
downstream ENSMUSE00000326975 Chr6:22272290..22272348 No primer for this exon
downstream ENSMUSE00000326966 Chr6:22271329..22271379 No primer for this exon
downstream ENSMUSE00000191314 Chr6:22268934..22269018 ACTCAATGAATGGTGCCACA Chr6:22268976..22268995 59.97 45
downstream ENSMUSE00000191319 Chr6:22259327..22259453 CCCAGTTATCTCGGAAACCA Chr6:22259352..22259371 59.93 50
downstream ENSMUSE00000656305 Chr6:22257891..22258538 CTTCCCGTCAGTCTTGCTTC Chr6:22258420..22258439 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCATTAATCGCCTTGCAG Chr6:22279513..22279533 58.39 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGTGTTCATCGTGACTGG Chr6:22279518..22279539 60.21 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029672