Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26592
Trapped Gene
Txndc15 (ENSMUSG00000021497)
Vector Insertion
Chr 13: 55826000 - 55827027
Public Clones not available
Private Clones OST109139 (lexicon) OST101368 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000118379 (Chr13:55825869..55825999 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000118379 (Chr13:55825869..55825999 +)
Downstram Exon
ENSMUSE00000375708 (Chr13:55827028..55827591 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000118380 Chr13:55816104..55816205 No primer for this exon
upstream ENSMUSE00000118376 Chr13:55819153..55819628 No primer for this exon
upstream ENSMUSE00000118378 Chr13:55822940..55823103 No primer for this exon
upstream ENSMUSE00000118379 Chr13:55825869..55825999 No primer for this exon

*** Putative Vector Insertion (Chr 13: 55826000 - 55827027) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000375708 Chr13:55827028..55827591 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:55826051..55826071 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAACATCCGGGGGAGGAAG Chr13:55826011..55826031 62.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021497