Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26599
Trapped Gene
Prtg (ENSMUSG00000036030)
Vector Insertion
Chr 9: 72738680 - 72739615
Public Clones not available
Private Clones OST108617 (lexicon)
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000375893 (Chr9:72738584..72738679 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATACCACGTGAGGCTCCTG Chr9:72738596..72738615 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000375893 (Chr9:72738584..72738679 +)
Downstram Exon
ENSMUSE00000340670 (Chr9:72739616..72739802 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATACCACGTGAGGCTCCTG Chr9:72738596..72738615 60.13 55 AGAGGAGGTATTCGCCTTCG Chr9:72739689..72739708 60.72 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635590 Chr9:72655018..72655339 CTGCTGCTGTTGCTGCTACT Chr9:72655297..72655316 59.56 55
upstream ENSMUSE00000635589 Chr9:72657262..72657564 CAAATACGGGGCCATTCTTA Chr9:72657518..72657537 59.79 45
upstream ENSMUSE00000309286 Chr9:72690502..72690646 GCGTTTGAAGTCCATCCAGT Chr9:72690510..72690529 60.12 50
upstream ENSMUSE00000309264 Chr9:72692665..72692798 CTGGGAATTACCGCTGTGTT Chr9:72692721..72692740 59.99 50
upstream ENSMUSE00000407802 Chr9:72695716..72695853 AGGATATCCCAGACCCATCA Chr9:72695816..72695835 59.17 50
upstream ENSMUSE00000309215 Chr9:72696121..72696279 ACTTGGAAATGGCAACCTCA Chr9:72696155..72696174 60.49 45
upstream ENSMUSE00000309192 Chr9:72697559..72697718 GGAATTCCCTCACCCAAAAT Chr9:72697639..72697658 60 45
upstream ENSMUSE00000309167 Chr9:72699288..72699535 CAGATTATCCCGGAAGACGA Chr9:72699304..72699323 60.03 50
upstream ENSMUSE00000309138 Chr9:72702763..72702927 CTTGGAAACGACACGACTCA Chr9:72702792..72702811 59.87 50
upstream ENSMUSE00000389884 Chr9:72704582..72704887 TTACTGCAGCTACCCGTGTG Chr9:72704807..72704826 59.93 55
upstream ENSMUSE00000332741 Chr9:72706568..72706756 CTATTCGGGGCTACAAGCTG Chr9:72706655..72706674 59.86 55
upstream ENSMUSE00000375893 Chr9:72738584..72738679 AATACCACGTGAGGCTCCTG Chr9:72738596..72738615 60.13 55

*** Putative Vector Insertion (Chr 9: 72738680 - 72739615) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000340670 Chr9:72739616..72739802 AGAGGAGGTATTCGCCTTCG Chr9:72739689..72739708 60.72 55
downstream ENSMUSE00000383878 Chr9:72740035..72740162 GACAGCTGATCCACATGCAG Chr9:72740121..72740140 60.44 55
downstream ENSMUSE00000347876 Chr9:72741631..72741801 TGGTGTAGCGTGTCACCACT Chr9:72741744..72741763 60.23 55
downstream ENSMUSE00000393523 Chr9:72752512..72752694 GGTTCGACTCTGAAGCATCC Chr9:72752661..72752680 59.81 55
downstream ENSMUSE00000338515 Chr9:72753955..72754075 GGCTTTGCTTCGGTAGATCA Chr9:72754076..72754095 60.35 50
downstream ENSMUSE00000384050 Chr9:72755508..72755670 TTCCACTCTGCGCTGTCTTA Chr9:72755545..72755564 59.74 50
downstream ENSMUSE00000387136 Chr9:72758444..72758548 No primer for this exon
downstream ENSMUSE00000352082 Chr9:72759711..72761965 TAAAAGCAGACGGCCTGAGT Chr9:72759748..72759767 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGACCAGACTGTCAGCACTC Chr9:72738649..72738669 59.6 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGACCAGACTGTCAGCACTC Chr9:72738649..72738669 59.6 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036030