Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26621
Trapped Gene
Nr1h2 (ENSMUSG00000060601)
Vector Insertion
Chr 7: 51805502 - 51805669
Public Clones not available
Private Clones OST107088 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000464617 (Chr7:51805670..51805878 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTGGACGATGCAGAGTAT Chr7:51805799..51805818 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000464617 (Chr7:51805670..51805878 -)
Downstram Exon
ENSMUSE00000674803 (Chr7:51804986..51805501 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTGGACGATGCAGAGTAT Chr7:51805799..51805818 60.25 55 CAAGGTGCATGGTGTGGTAG Chr7:51805074..51805093 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000595347 Chr7:51809179..51809293 GAGCTACTCCCAGGCTTCTG Chr7:51809230..51809249 59.19 60
upstream ENSMUSE00000674806 Chr7:51809179..51809318 CGGAAGAAGTGGCGAAGTTA Chr7:51809284..51809303 60.38 50
upstream ENSMUSE00000595346 Chr7:51808949..51809078 GTTTCCAGGGCAACAGAGTC Chr7:51809041..51809060 59.7 55
upstream ENSMUSE00000674805 Chr7:51808949..51809056 No primer for this exon
upstream ENSMUSE00000595345 Chr7:51808067..51808124 CTGCTTCGTGACCCACTATG Chr7:51808104..51808123 59.31 55
upstream ENSMUSE00000674804 Chr7:51808067..51808127 CTGCTTCGTGACCCACTATG Chr7:51808104..51808123 59.31 55
upstream ENSMUSE00000708895 Chr7:51808067..51808124 CTGCTTCGTGACCCACTATG Chr7:51808104..51808123 59.31 55
upstream ENSMUSE00000595344 Chr7:51807877..51807990 GGTCCAGCTCTGCCTACATC Chr7:51807881..51807900 59.83 60
upstream ENSMUSE00000595343 Chr7:51807325..51807615 GGCTTCCACTACAACGTGCT Chr7:51807492..51807511 60.32 55
upstream ENSMUSE00000674802 Chr7:51807325..51807606 GGCTTCCACTACAACGTGCT Chr7:51807492..51807511 60.32 55
upstream ENSMUSE00000467605 Chr7:51806970..51807229 AAACGATCTTTCTCCGACCA Chr7:51806983..51807002 59.67 45
upstream ENSMUSE00000532492 Chr7:51806688..51806867 ACTTCACCGAGCTAGCCATC Chr7:51806790..51806809 59.46 55
upstream ENSMUSE00000465621 Chr7:51806115..51806214 CAGACGCTACAACCACGAGA Chr7:51806175..51806194 60.05 55
upstream ENSMUSE00000464617 Chr7:51805670..51805878 GCCTGGACGATGCAGAGTAT Chr7:51805799..51805818 60.25 55

*** Putative Vector Insertion (Chr 7: 51805502 - 51805669) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674801 Chr7:51805005..51805501 CAAGGTGCATGGTGTGGTAG Chr7:51805074..51805093 60.03 55
downstream ENSMUSE00000471235 Chr7:51804987..51805501 CAAGGTGCATGGTGTGGTAG Chr7:51805074..51805093 60.03 55
downstream ENSMUSE00000674803 Chr7:51804986..51805501 CAAGGTGCATGGTGTGGTAG Chr7:51805074..51805093 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTAATCGCCTTGCAGCAC Chr7:51805601..51805621 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000060601