Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26624
Trapped Gene
Mpdu1 (ENSMUSG00000018761)
Vector Insertion
Chr 11: 69470831 - 69470921
Public Clones not available
Private Clones OST107012 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111809 (Chr11:69470922..69471032 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111809 (Chr11:69470922..69471032 -)
Downstram Exon
ENSMUSE00000334135 (Chr11:69470205..69470830 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000329630 Chr11:69475971..69476073 No primer for this exon
upstream ENSMUSE00000706015 Chr11:69475971..69476073 No primer for this exon
upstream ENSMUSE00000329624 Chr11:69472313..69472378 No primer for this exon
upstream ENSMUSE00000111810 Chr11:69472068..69472200 No primer for this exon
upstream ENSMUSE00000111813 Chr11:69471438..69471523 No primer for this exon
upstream ENSMUSE00000111811 Chr11:69471227..69471345 No primer for this exon
upstream ENSMUSE00000111809 Chr11:69470922..69471032 No primer for this exon
upstream ENSMUSE00000588590 Chr11:69470922..69471032 No primer for this exon

*** Putative Vector Insertion (Chr 11: 69470831 - 69470921) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000588587 Chr11:69470655..69470713 No primer for this exon
downstream ENSMUSE00000334135 Chr11:69470205..69470830 No primer for this exon
downstream ENSMUSE00000588588 Chr11:69470205..69470830 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGCTTAATCGCCTTGCAG Chr11:69470856..69470876 61.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCGAATCTTCACTTCTGT Chr11:69470924..69470944 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018761