Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26625
Trapped Gene
Cdc2l6 (ENSMUSG00000038481)
Vector Insertion
Chr 10: 40186576 - 40189384
Public Clones not available
Private Clones OST107005 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000498551 (Chr10:40186444..40186575 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGTTTTGCCAGGTTATTC Chr10:40186450..40186469 59.8 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000498551 (Chr10:40186444..40186575 +)
Downstram Exon
ENSMUSE00000614591 (Chr10:40189385..40189528 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGTTTTGCCAGGTTATTC Chr10:40186450..40186469 59.8 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000488186 Chr10:40069114..40069527 ATGATTTCAAGGCGAAGCTG Chr10:40069407..40069426 60.35 45
upstream ENSMUSE00000483776 Chr10:40114131..40114206 CAAATCGAAGGCACAGGAAT Chr10:40114159..40114178 60.07 45
upstream ENSMUSE00000614594 Chr10:40154110..40154220 TGGCTGCTGTTTGACTATGC Chr10:40154185..40154204 60.02 50
upstream ENSMUSE00000614593 Chr10:40155878..40156018 ATTACCTCCACGCAAACTGG Chr10:40155981..40156000 59.99 50
upstream ENSMUSE00000614592 Chr10:40173821..40173878 TGAAAGGGGGAGAGTCAAAAT Chr10:40173856..40173876 59.93 42.86
upstream ENSMUSE00000498551 Chr10:40186444..40186575 TGGGTTTTGCCAGGTTATTC Chr10:40186450..40186469 59.8 45

*** Putative Vector Insertion (Chr 10: 40186576 - 40189384) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000614591 Chr10:40189385..40189528 No primer for this exon
downstream ENSMUSE00000614590 Chr10:40189692..40189761 TTGGGTACTCTGGCATTTTTCT Chr10:40189734..40189755 60 40.91
downstream ENSMUSE00000614589 Chr10:40195375..40195447 GCTGTCAGGCTTGACCTTGT Chr10:40195435..40195454 60.45 55
downstream ENSMUSE00000614588 Chr10:40195963..40196060 GTTGGATCCATGGTGAGGAG Chr10:40195994..40196013 60.33 55
downstream ENSMUSE00000614587 Chr10:40196695..40196773 CTTTTGGGGTACGGAATCTG Chr10:40196733..40196752 59.42 50
downstream ENSMUSE00000614586 Chr10:40197508..40197774 GATAATCCGACGGCATAACG Chr10:40197775..40197794 60.31 50
downstream ENSMUSE00000614585 Chr10:40199481..40203624 TTGATCAGCGTGACTCCTTG Chr10:40200465..40200484 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTACTTGGTGCCAGGCATT Chr10:40186542..40186562 60.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTACTTGGTGCCAGGCATT Chr10:40186542..40186562 60.5 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038481