Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26627
Trapped Gene
A130022J15Rik (ENSMUSG00000035245)
Vector Insertion
Chr 6: 97095389 - 97095479
Public Clones not available
Private Clones OST106858 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695380 (Chr6:97095390..97095478 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGACAAGGCTCATTCTGA Chr6:97095391..97095410 58.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695380 (Chr6:97095390..97095478 -)
Downstram Exon
ENSMUSE00000397153 (Chr6:97095255..97095478 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGACAAGGCTCATTCTGA Chr6:97095391..97095410 58.96 50 CCTCAGAATGAGCCTTGTCC Chr6:97095367..97095386 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000424099 Chr6:97098826..97098877 No primer for this exon
upstream ENSMUSE00000695384 Chr6:97098826..97098921 ACGTCTCGTTACTCCCAAGC Chr6:97098868..97098887 59.36 55
upstream ENSMUSE00000695383 Chr6:97098185..97098252 CCGTGAAAATCCAATCAAGC Chr6:97098231..97098250 60.45 45
upstream ENSMUSE00000424088 Chr6:97097871..97098252 AAGACGCGGTAGCCTAACCT Chr6:97098173..97098192 60.28 55
upstream ENSMUSE00000695381 Chr6:97097871..97098002 TTTTGTTAACCGGCAGAACG Chr6:97097938..97097957 61.02 45
upstream ENSMUSE00000424085 Chr6:97097389..97097445 GCTAGCCAAAGCATCAGCAG Chr6:97097419..97097438 61.21 55
upstream ENSMUSE00000695380 Chr6:97095390..97095478 CAGGACAAGGCTCATTCTGA Chr6:97095391..97095410 58.96 50

*** Putative Vector Insertion (Chr 6: 97095389 - 97095479) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397153 Chr6:97095255..97095478 CCTCAGAATGAGCCTTGTCC Chr6:97095367..97095386 59.8 55
downstream ENSMUSE00000245355 Chr6:97093934..97094034 CCAAGTCGACATAGCTGCAA Chr6:97093916..97093935 60.01 50
downstream ENSMUSE00000245352 Chr6:97092820..97092928 AGAACATGTCCTGGGCTGAC Chr6:97092872..97092891 60.12 55
downstream ENSMUSE00000379327 Chr6:97085170..97085264 TGAAGGTAACGGGAGCAAAC Chr6:97085208..97085227 60.11 50
downstream ENSMUSE00000335901 Chr6:97084273..97084377 GACTTTTACGCTGCCCTTCA Chr6:97084264..97084283 60.39 50
downstream ENSMUSE00000245335 Chr6:97081346..97081452 AAATTGAGCTGCGTGTAGCC Chr6:97081395..97081414 60.42 50
downstream ENSMUSE00000245330 Chr6:97075514..97075617 ATGTACACGTCCGTGCTGAA Chr6:97075508..97075527 60.18 50
downstream ENSMUSE00000245323 Chr6:97070706..97070798 TCCAGGTATCGGAGAAGAGG Chr6:97070737..97070756 59.23 55
downstream ENSMUSE00000245312 Chr6:97070138..97070209 CAACGAAAACACGGCTTCTT Chr6:97070158..97070177 60.28 45
downstream ENSMUSE00000245304 Chr6:97069957..97070043 GCTGGGAGAAGGCTCTGAAT Chr6:97069976..97069995 60.87 55
downstream ENSMUSE00000392298 Chr6:97068875..97068943 CTGCGTGCAAGAATGGTAAC Chr6:97068887..97068906 59.35 50
downstream ENSMUSE00000384584 Chr6:97065995..97066056 TAATCAACCACCCGGACTTC Chr6:97065982..97066001 59.79 50
downstream ENSMUSE00000245291 Chr6:97063837..97063956 GTGTTGTGCGTGATCCTGAG Chr6:97063893..97063912 60.32 55
downstream ENSMUSE00000245283 Chr6:97062675..97062777 TAGCAGCGCTCATCTTCACA Chr6:97062729..97062748 60.85 50
downstream ENSMUSE00000695379 Chr6:97062675..97062727 CTTCCGCCAGGTGATGTAGT Chr6:97062680..97062699 60.13 55
downstream ENSMUSE00000695378 Chr6:97061995..97062200 GTACATGCTCTGCAGCCTGA Chr6:97062079..97062098 60.17 55
downstream ENSMUSE00000397658 Chr6:97060938..97062200 TTGTCAGGCTCTTGATGCAC Chr6:97061274..97061293 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000035245