Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26629
Trapped Gene
Slc27a1 (ENSMUSG00000031808)
Vector Insertion
Chr 8: 74093348 - 74094619
Public Clones not available
Private Clones OST106763 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000342624 (Chr8:74093241..74093347 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTCGGAGTCTGGAATGCT Chr8:74093272..74093291 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000342624 (Chr8:74093241..74093347 +)
Downstram Exon
ENSMUSE00000380470 (Chr8:74094620..74094787 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTCGGAGTCTGGAATGCT Chr8:74093272..74093291 59.95 50 CTTGCAGACGATACGCAGAA Chr8:74094770..74094789 60.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387874 Chr8:74092826..74092922 GCTCAGAACTTCCCAGTCCA Chr8:74092858..74092877 60.39 55
upstream ENSMUSE00000342624 Chr8:74093241..74093347 TTCTCGGAGTCTGGAATGCT Chr8:74093272..74093291 59.95 50

*** Putative Vector Insertion (Chr 8: 74093348 - 74094619) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000380470 Chr8:74094620..74094787 CTTGCAGACGATACGCAGAA Chr8:74094770..74094789 60.16 50
downstream ENSMUSE00000330473 Chr8:74103303..74103697 GCTCTAGCCGAACACGAATC Chr8:74103340..74103359 59.99 55
downstream ENSMUSE00000213264 Chr8:74103806..74103967 AGCAGAACTTGAGGAGGCTCT Chr8:74103858..74103878 59.78 52.38
downstream ENSMUSE00000330455 Chr8:74104044..74104113 ACAATGGCAGCCTTAGGAAG Chr8:74104104..74104123 59.34 50
downstream ENSMUSE00000213255 Chr8:74104509..74104600 AAGGCAGCAATGCGGTAGTA Chr8:74104532..74104551 60.79 50
downstream ENSMUSE00000213260 Chr8:74104666..74104775 AGTACCACCGTCAACCCGTA Chr8:74104720..74104739 60.29 55
downstream ENSMUSE00000213267 Chr8:74108017..74108226 AGCGGCAGATTTCACCTATG Chr8:74108050..74108069 60.24 50
downstream ENSMUSE00000213270 Chr8:74108319..74108445 TCCATCGTGTCCTCATTGAC Chr8:74108404..74108423 59.48 50
downstream ENSMUSE00000213252 Chr8:74108532..74108669 TGTGGGCAATCTTCTTGTTG Chr8:74108636..74108655 59.69 45
downstream ENSMUSE00000213262 Chr8:74108741..74108905 CGTCCATCACTAGCACGTCA Chr8:74108764..74108783 60.9 55
downstream ENSMUSE00000213268 Chr8:74109245..74109391 No primer for this exon
downstream ENSMUSE00000493162 Chr8:74109801..74110607 CAGCCACTCAGGTTCCATTT Chr8:74110090..74110109 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGATCTAGGACAAGCTGGA Chr8:74093308..74093329 59.82 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTAGGACAAGCTGGATCAGG Chr8:74093313..74093334 59.44 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031808