Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26665
Trapped Gene
Anapc5 (ENSMUSG00000029472)
Vector Insertion
Chr 5: 123268014 - 123268862
Public Clones not available
Private Clones OST105124 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189215 (Chr5:123268863..123268972 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCGAACTGAAGGATATGG Chr5:123268935..123268954 59.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189215 (Chr5:123268863..123268972 -)
Downstram Exon
ENSMUSE00000189216 (Chr5:123267830..123268013 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCGAACTGAAGGATATGG Chr5:123268935..123268954 59.15 50 CTCCATCCTCTCGGTCCATA Chr5:123267848..123267867 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000537625 Chr5:123270989..123271289 GACTGGGTGACGCCCTATAA Chr5:123271095..123271114 59.96 55
upstream ENSMUSE00000189217 Chr5:123269617..123269696 CCTCAGCTGGCAAATTCAGT Chr5:123269626..123269645 60.4 50
upstream ENSMUSE00000189215 Chr5:123268863..123268972 AGGCGAACTGAAGGATATGG Chr5:123268935..123268954 59.15 50

*** Putative Vector Insertion (Chr 5: 123268014 - 123268862) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189216 Chr5:123267830..123268013 CTCCATCCTCTCGGTCCATA Chr5:123267848..123267867 60.03 55
downstream ENSMUSE00000189219 Chr5:123264558..123264624 TTTTTGGGACAGAGGACCAC Chr5:123264563..123264582 59.94 50
downstream ENSMUSE00000390362 Chr5:123257309..123257410 GGGTGAGGGCTTTAGTCTCAT Chr5:123257349..123257369 59.59 52.38
downstream ENSMUSE00000537622 Chr5:123256283..123256444 AGGCGGTCAAAATAATGCAG Chr5:123256340..123256359 60.1 45
downstream ENSMUSE00000537620 Chr5:123256254..123256280 No primer for this exon
downstream ENSMUSE00000537645 Chr5:123256254..123256444 AGGCGGTCAAAATAATGCAG Chr5:123256340..123256359 60.1 45
downstream ENSMUSE00000502536 Chr5:123252832..123252913 CACACGTGATCGTTGGACTC Chr5:123252826..123252845 60.16 55
downstream ENSMUSE00000537642 Chr5:123252832..123252913 CACACGTGATCGTTGGACTC Chr5:123252826..123252845 60.16 55
downstream ENSMUSE00000506123 Chr5:123252139..123252228 CACAGAGTGCTCCAGCAGAA Chr5:123252144..123252163 60.33 55
downstream ENSMUSE00000537641 Chr5:123252139..123252228 CACAGAGTGCTCCAGCAGAA Chr5:123252144..123252163 60.33 55
downstream ENSMUSE00000505228 Chr5:123250460..123250641 TCCTTTAGGGCATCCATCAG Chr5:123250531..123250550 60.03 50
downstream ENSMUSE00000537639 Chr5:123250460..123250641 TCCTTTAGGGCATCCATCAG Chr5:123250531..123250550 60.03 50
downstream ENSMUSE00000475386 Chr5:123249348..123249483 ACTCCAGGCTGTTCATGCTC Chr5:123249409..123249428 60.42 55
downstream ENSMUSE00000537638 Chr5:123249348..123249483 ACTCCAGGCTGTTCATGCTC Chr5:123249409..123249428 60.42 55
downstream ENSMUSE00000474501 Chr5:123244426..123244500 GAAATCGGTCCTTCAAGTGC Chr5:123244427..123244446 59.68 50
downstream ENSMUSE00000537636 Chr5:123244426..123244500 GAAATCGGTCCTTCAAGTGC Chr5:123244427..123244446 59.68 50
downstream ENSMUSE00000469515 Chr5:123243446..123243567 CTATGCCATTAAGCGCTGTG Chr5:123243437..123243456 59.49 50
downstream ENSMUSE00000537634 Chr5:123243446..123243567 CTATGCCATTAAGCGCTGTG Chr5:123243437..123243456 59.49 50
downstream ENSMUSE00000468577 Chr5:123241836..123241943 GCCTGCAGTACGACTGCTTT Chr5:123241901..123241920 60.6 55
downstream ENSMUSE00000537631 Chr5:123241836..123241943 GCCTGCAGTACGACTGCTTT Chr5:123241901..123241920 60.6 55
downstream ENSMUSE00000471257 Chr5:123241617..123241764 ACAGTTTCGGAGGCCAAGTA Chr5:123241617..123241636 59.73 50
downstream ENSMUSE00000537600 Chr5:123241617..123241764 ACAGTTTCGGAGGCCAAGTA Chr5:123241617..123241636 59.73 50
downstream ENSMUSE00000470352 Chr5:123238311..123238473 AAGAACATGGCACGACCTTT Chr5:123238348..123238367 59.6 45
downstream ENSMUSE00000537628 Chr5:123238311..123238473 AAGAACATGGCACGACCTTT Chr5:123238348..123238367 59.6 45
downstream ENSMUSE00000363961 Chr5:123237740..123238027 ATGGCACAATGGTTCCTCTC Chr5:123237858..123237877 59.93 50
downstream ENSMUSE00000537626 Chr5:123237740..123238027 ATGGCACAATGGTTCCTCTC Chr5:123237858..123237877 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCAGAGGTTCACAAAACGA Chr5:123268870..123268891 59.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCAGAGGTTCACAAAACGA Chr5:123268870..123268891 59.62 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029472