Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26677
Trapped Gene
Krt42 (ENSMUSG00000053654)
Vector Insertion
Chr 11: 100128597 - 100130723
Public Clones CMHD-GT_410A9-3 (cmhd)
Private Clones OST104361 (lexicon) OST59406 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000480613 (Chr11:100130724..100131185 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTTTTGGTGTGTCGGATG Chr11:100130924..100130943 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000480613 (Chr11:100130724..100131185 -)
Downstram Exon
ENSMUSE00000479535 (Chr11:100128514..100128596 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTTTTGGTGTGTCGGATG Chr11:100130924..100130943 60 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000480613 Chr11:100130724..100131185 CAGTTTTGGTGTGTCGGATG Chr11:100130924..100130943 60 50

*** Putative Vector Insertion (Chr 11: 100128597 - 100130723) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000479535 Chr11:100128514..100128596 No primer for this exon
downstream ENSMUSE00000482447 Chr11:100128249..100128405 TTCCTCAGATAGGCCAGCTC Chr11:100128240..100128259 59.53 55
downstream ENSMUSE00000462189 Chr11:100126914..100127075 ACCATTCCTCAGCATCCTTG Chr11:100126903..100126922 60.07 50
downstream ENSMUSE00000673010 Chr11:100126914..100127292 ACCATTCCTCAGCATCCTTG Chr11:100126903..100126922 60.07 50
downstream ENSMUSE00000112614 Chr11:100126243..100126368 GGAGCTCCGTGATCTCTGTC Chr11:100126271..100126290 59.95 60
downstream ENSMUSE00000439991 Chr11:100125792..100126012 CTCCAGTCGGGTCTTCACAT Chr11:100125817..100125836 60.11 55
downstream ENSMUSE00000439986 Chr11:100124608..100124657 GCCAGGGATGAGGAGTATTG Chr11:100124606..100124625 59.51 55
downstream ENSMUSE00000381420 Chr11:100124202..100124481 TGGGCTATCATACGCAGACA Chr11:100124336..100124355 60.24 50
downstream ENSMUSE00000673009 Chr11:100124196..100124481 TGGGCTATCATACGCAGACA Chr11:100124336..100124355 60.24 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACAAGGTGGGAGCCTCTT Chr11:100130709..100130729 60.63 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACAAGGTGGGAGCCTCTT Chr11:100130709..100130729 60.63 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053654