Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26686
Trapped Gene
Agpat6 (ENSMUSG00000031545)
Vector Insertion
Chr 8: 24293436 - 24295000
Public Clones not available
Private Clones OST103559 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000449859 (Chr8:24295001..24295070 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAGCCAAGGAGAGGAAC Chr8:24295029..24295048 60.34 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000449859 (Chr8:24295001..24295070 -)
Downstram Exon
ENSMUSE00000343846 (Chr8:24293135..24293435 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAGCCAAGGAGAGGAAC Chr8:24295029..24295048 60.34 60 TCGGGTGTCTTATCCAGAGC Chr8:24293323..24293342 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000449884 Chr8:24318771..24318833 GCAGTCACCGAGGACTGGAG Chr8:24318787..24318806 63.39 65
upstream ENSMUSE00000449870 Chr8:24301188..24302164 GGACAAATTTACCCGCTGAA Chr8:24301709..24301728 59.94 45
upstream ENSMUSE00000449859 Chr8:24295001..24295070 GAGGAGCCAAGGAGAGGAAC Chr8:24295029..24295048 60.34 60

*** Putative Vector Insertion (Chr 8: 24293436 - 24295000) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000343846 Chr8:24293135..24293435 TCGGGTGTCTTATCCAGAGC Chr8:24293323..24293342 60.22 55
downstream ENSMUSE00000210602 Chr8:24292245..24292319 CCACTACCAAGAGGCCAATC Chr8:24292257..24292276 59.55 55
downstream ENSMUSE00000449839 Chr8:24291332..24291421 CGCACACAGATACGGTAGCA Chr8:24291343..24291362 60.89 55
downstream ENSMUSE00000449836 Chr8:24291105..24291198 TCAATGGGGGATGTATGGTT Chr8:24291120..24291139 59.87 45
downstream ENSMUSE00000523329 Chr8:24290573..24290688 CAGAACGCTCAAACCAGACA Chr8:24290582..24290601 60.03 50
downstream ENSMUSE00000355485 Chr8:24290241..24290296 GGCAGCTTGCTTTTATCCTG Chr8:24290239..24290258 59.98 50
downstream ENSMUSE00000523328 Chr8:24289887..24289972 AGGGTAAACAGTGGCTCCAA Chr8:24289877..24289896 59.59 50
downstream ENSMUSE00000523327 Chr8:24285980..24286108 GTACCAAACGCTGCAGACAA Chr8:24285979..24285998 59.91 50
downstream ENSMUSE00000399554 Chr8:24285812..24285891 GGCAATGGCAGACTTCACTC Chr8:24285819..24285838 60.81 55
downstream ENSMUSE00000449866 Chr8:24284207..24285132 GGAGTCCAGAACAGCCTGAG Chr8:24284854..24284873 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCTGAAGTAACACCCTCA Chr8:24294952..24294972 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTGAAGTAACACCCTCA Chr8:24294952..24294972 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031545